SimpleSearch - Line and FST details


Line specific information

 
Line ID 131F01
Vector Used pAC161
Line Availability only available from NASC (N412541)
Segregation Analysis 100:98:93
Confirmed for Hit At1g20620
Parent of DUPLO pair none
Parent of pair(s) 3185, 10811

Gene hit At1g20620

 
Sequence (A. th genome BLAST matches underlined)
>06-K012721-022-131-F01-8409
TTGATCCATGTAGATTTACCCGGACATGAATGCCTTTACAATTGAATATATCTGGTACTG
TTCGCGTCATCAAATACTAAACCCTTATTTGGCTAATACTGGTGCCGAAAACTACTCTTC
GTAGGGACGGACCACCCTGGTACTCTCCACTCAAGAAACGGGGCTTGATATTGATACAGG
ATACGACTTAGCAATAGGGCTTGGTATCGAACCAATCCCCTGACAGCAAAATATAGTGGA
TAGCTCTTCGCGACCCCGGTGGACTGGGGACCAACTTTCTTCCTGGACACGATGCATCAT
CGATCGGATAATGCTGATTGCAGTATCATCCTTCAAGCGCGTACAACGCCCCATTCTACA
CCACAGACGGTGGTGCTCCAGTCTCCAACAACATCTGTTCCCTCACCATCGGAGAAAGAG
GTATCGCAACCCTGAATTTCACGAGTCTATCAATAAGAATCGGAACTTGTTGGATTTATG
AAAGAGATAAAACTGAGATGTGGAGTCTAAGCTGAGATCTTGTTCGTGAAGCGTGATGTG
ATTATTTTTAACATGTGTTACTTCGTAATGGGCAGGGTCCGGGTCTTCTTTGAGGATAGT
CATTTGATCCGAAAAGGTTGCTTATTTCCCCAAAGAGA
GenBank Accession AL764835 [GenBank]
Graphic View Graphic view of gene At1g20620
Predicted Position of Insertion Chr1:7143942 - go to primer design
BLAST e Value 3e-140
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation catalase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03