SimpleSearch - Line and FST details


Line specific information

 
Line ID 131F04
Vector Used pAC161
Line Availability only available from NASC (N412544)
Segregation Analysis 100:87:69
Confirmed for Hit At3g07650
Parent of DUPLO pair 2438
Parent of pair(s) none

Gene hit At3g07650

 
Sequence (A. th genome BLAST matches underlined)
>30-K012721-022-131-F04-8409
TTTGATCCATGTAGATTTCCCGGACATGTTTCCGATTTACGCGGGCATGCCTGCAGGTCG
ACCTGCAGCCAGCTATGGGATCCTCCCTATGTGAGTCGNATTACTCATGTGACTCTGGCT
TCTTTTTTCTGGAAACAGGTTTGATAAGAGAGTGAGGTATGCTTCCCGCAAAGCAAGAGC
TGATGTGAGACGGCGTGTAAAGGGGCGATTTGTCAAAGCTGGTGAAGCTTATGATTACGA
CCCTCTCACCCCAACCAGAAGTTATTGAAGACTCCTTTTGAAAGGTACATAGATATATAT
ACATGGCGAAGAATCGAACAAGAAAGGTTTTGACTTATGGGCAGTTTCAAGTGAGCAACT
TGGAAAATTGTGGGTTAGTAACAAAACAAGACTACTGTAGCATGAACAGATTTCAAGACT
GACTCTTGTAAGCAATCATTCATTCTTGGGATTCAATCGTTTTTTTTGGCCTCAGAAGCT
TCATTCTTGACCAGAGGGATTATTCTCTGACTTTCCTTGTCCAAACTCCGGTTTCTTCTT
CTTCTTCTTCAGGCGTCTCACACTGATCAGGGGTCCATGAATTTTGTTCTTCTCTTGGTA
GTTAAAAAGGGCAGGAAGGAAGATTAGAAGTATTTCAACAATATGGGATTGGTGAATATG
CCTTTGT
GenBank Accession BX572183 [GenBank]
Graphic View Graphic view of gene At3g07650
Predicted Position of Insertion Chr3:2443740 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MLP3
Hit Gene Code At3g07650 [TAIR] [MIPS] [SIGnAL]
Gene Annotation CONSTANS-like 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23