SimpleSearch - Line and FST details


Line specific information

 
Line ID 134E10
Vector Used pAC161
Line Availability only available from NASC (N412826)
Segregation Analysis 100:60:42
Confirmed for Hit At4g39400
Parent of DUPLO pair none
Parent of pair(s) 3399, 3699, 3733

Gene hit At4g39400

 
Sequence (A. th genome BLAST matches underlined)
>77-K012718-022-134-E10-8409
TTGATCCATGTAGAATCTCGCTATCTCTCAAGCTAAGCACAATTCATTCTCCGGGAACAT
TCCGGCTGAGCTCGGCGACTGCAGAAGCTTAATCTGGCTTGATCTAACACCAATCTCTTC
AATGGAACGATTCCGGCGGCGATGTTTAAACAATCCGGGAAAATCGCGTGCCAATTTCAT
CGCCGGTAAGAGGTACGTTTATATCAAAAACGATGGGATGAAGAAAGAGTGTCATGGAGC
TGGTAATTTACTTGAGTTTCAAGGAATCAGATCCGAACAATTAAACCGGCTTTCAACGAG
GAACCCTTGTAATATCACTATGGGATCCTCCCTATAGTGAGTCGTATTTACTCAACCNGC
TCANAACAGTTGCTTAAAGTCGGTGGAATCTTCCCGGTGAAGCCATTGTTCTGAAGGTAA
AGCTCCTGCAGAGTGTTTTTAGGGTTCTGGCAGAGATTTGGGAGAATCGGACCGGAGAAA
TTGTTGGAGCTGAAATCTAACGTTTGCAACGAAGCGGATAGATTCCTCAGAAATTTCCGG
AATTCCCCCGAAAACTCCGTGAAAAACAGATCAAGAACCTTGAAGTCCTCTC
GenBank Accession AL765066 [GenBank]
Graphic View Graphic view of gene At4g39400
Predicted Position of Insertion Chr4:18326432 - go to primer design
BLAST e Value 3e-156
Hit Clone Code (BAC ID) F23K16
Hit Gene Code At4g39400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40