SimpleSearch - Line and FST details


Line specific information

 
Line ID 135D07
Vector Used pAC161
Line Availability only available from NASC (N412907)
Segregation Analysis 100:80:51
Confirmed for Hit At3g51260
Parent of DUPLO pair 2257
Parent of pair(s) none

Gene hit At3g51260

 
Sequence (A. th genome BLAST matches underlined)
>24-K017715-022-135-D07C-8409
TCCATGTAGATTTCCCGGACATGAAGCCATTTACATCCGTGTAGAGTTTTTGTATTCTCC
CCCGATGGTCACCTCTTCCAAGTAGAGTATGCCCTAGAAGCCGTCCGAAAGGGTAACGCC
GCCGTCGGAGTCCGCGGCACAGATACTGTCGTCCTCGCCGTCGAAAAGAAATCCACCCCT
AAGCTCCAGGATTCCAGGTATTGCTCCGATCTCTACCGATACAAGATGCTTAAACCGGAT
TTAGTCCATTTACTTTTGTTTCTGCACTTTGATTTTGGTTTTAAGCTTCACCTGGATAGC
TCGCTTGATTTACTCAATTGCTACTTGTATGATCACTGTTTCAATCCTTCTGAACTAAAT
CCTGATGTTGGGATTTTGTATCACTTCGTAATTGCGAATCTAGTATTGTTAGATCGTAGA
ATCTGAGCTGAACCCTAGTTTAAGTCTTTTTTCTCTACGAGGGTACAATTACAGTTCCTG
TATCTCAAACGTGTTTTTTTGTATAAAAACACGTTTTTGGTTATACTCTGCAA
GenBank Accession queueing for submission to ENA/GenBank
Graphic View Graphic view of gene At3g51260
Predicted Position of Insertion Chr3:19031112 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24M12
Hit Gene Code At3g51260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 20S proteasome alpha subunit PAD1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on 31.08.2016 09:40