SimpleSearch - Line and FST details


Line specific information

 
Line ID 135H09
Vector Used pAC161
Line Availability only available from NASC (N412957)
Segregation Analysis 50:48:47
Confirmed for Hit At5g41760
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g29760

 
Sequence (A. th genome BLAST matches underlined)
>72-K012800-022-135-H09-35St
TTCCCCTATCCTTCGCAAGACCCTTCCTCTATATAAGGATTTTCATTTCATTTGGAGAGG
ACAGGGCACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTGG
TCCATTGTGGAAGGGGGACCCGTCCGGACAAGTTGCTTGAGTCGGAGTTGAGATGTCCGG
CTCTACGGGAGAGATCCACCAAGCACTGCCCAACGTTTTGCAGCTCACGGAGCTGGATTC
TCTCTGACGGTCGATAAACCGAACGTCCGATAAGATAGACGGAGGATACGAGACGCTCTC
TCCGTAACACTCCCACGATTCACTTACTTCCCTAATA
GenBank Accession FR804028 [GenBank]
Graphic View Graphic view of gene At3g29760
Predicted Position of Insertion Chr3:11589647 - go to primer design
BLAST e Value 1e-04
Hit Clone Code (BAC ID) MOD1
Hit Gene Code At3g29760 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Haloacid dehalogenase-like hydrolase (HAD) superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At5g41760

 
Sequence (A. th genome BLAST matches underlined)
>72-K012755-022-135-H09-8409
ATTGACTTCTGGTACTTCATCTTGCTAATTATGATTGATATCGAGATTCGTTTCCTCTAT
GTTTCGACATTGCCTGATCTCTTATAATTTCGGCGACTTTATAGATCTATGGGATCCTCC
CTATAGTGTTGANTNAACCCTACAGCCAAGGCCGAACGCTACTCCATAGAGACACTGCAT
CATCTTATACATATCCTATCTGGATGGACATAGCCTTGTGCATTTTGTTATCGAGCAGGT
TCAAACACATGCTCGATTNTNCACATGAGTATTATCTCTCATTGTCTTAGAGATACATTT
TCGTTTAAAGAGACCATGGCGCTTGAAGAACAGA
GenBank Accession AL765170 [GenBank]
Graphic View Graphic view of gene At5g41760
Predicted Position of Insertion Chr5:16706931 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) MUF8
Hit Gene Code At5g41760 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-sugar transporter family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23