SimpleSearch - Line and FST details


Line specific information

 
Line ID 136D10
Vector Used pAC161
Line Availability only available from NASC (N413006)
Segregation Analysis 100:93:70
Confirmed for Hit At2g42300
Parent of DUPLO pair none
Parent of pair(s) 2455

Gene hit At2g42300

 
Sequence (A. th genome BLAST matches underlined)
>76-K012754-022-136-D10-8409
NTGATCCATGTGAGATTTCCCGGGACATGAAGCCTTTACAATTGAATATATCCAGTGAGC
TAGAACGGAAAGCTCTAGAAACAGCATCGTGCATCGCATGGATCCTTTTTGAAAACCTAT
GGGATCCTCCCTATAGTGAGTCGGATTACTCANCTGCCGGCCNNAGCTGTCTGGTCGGTC
CGAAAGAAAGAGGAACAAGGCCTAGTTTTTAAAAATATATGTGGTTAACGAACCACTGTG
AAAATGAGCCTTAATCCTAGGTAGCATATGTATAACGGGTTCTATAAAATCAACAACTCT
ACTCTTTTCAAGATAATATGCCAGAAGAGCGAATCAGAGCAACATCTGTAGTTTACAAAC
ATGGATTCAGGATTTCTCAGGATTTCATGAAGCAGACAATCGAGTCCCAAAACCCCACAA
ATTTGACAAACTCTTAAAGAGTTGTCACTTATGATCATCTCCTTCCACCAATAATTGCAG
CTAAATTCCAAGATATCTATGGATTAGTTAGCTGTCTGCAGGAGTGTCACATCATGTATC
CAACCAATGACGTATTGTGGGGACTCAAAGCATATAACAATATTAGTGACGATACTACAC
TCCTCACCCTCTTTCTACTTGATAGATACCAAACTTATTAGAGACGATACTACACTCCTT
ACCCTCCATAGAAAGCCCTGCACCTTTGGCCACTTATTATCAAAAAGATGACCCCCAAAC
CCAGGCTGGCCTTGGTCTATTCCACAAAATCTGTCCCCTCTACCCAAAACCTTAGGGAAC
AGT
GenBank Accession AL765216 [GenBank]
Graphic View Graphic view of gene At2g42300
Predicted Position of Insertion Chr2:17623535 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MHK10
Hit Gene Code At2g42300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03