SimpleSearch - Line and FST details


Line specific information

 
Line ID 136D11
Vector Used pAC161
Line Availability only available from NASC (N413007)
Segregation Analysis 150:106:73
Confirmed for Hit At5g11300 At5g11330
Parent of DUPLO pair none
Parent of pair(s) 3543, 3689, 9763

Gene hit At5g11300

 
Sequence (A. th genome BLAST matches underlined)
>84-K012754-022-136-D11-8409
TGATCCATGTAGATTTCCCGGACTGAAGATCTGAATGTAGTGCGTTGTTTCTTATATTAT
TTTGCAGGTGCCTTTCATTGAACTGGAGTATTTAGCAAACTATCTCGCCGAATTGACACT
GGTGGAATATAGTTTCCTAAGGTTCCTGCCATCACTAATTGCTGCTTCAGCTGTTTTCCT
ATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession BX890773 [GenBank]
Graphic View Graphic view of gene At5g11300
Predicted Position of Insertion Chr5:3602383 - go to primer design
BLAST e Value 6e-77
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitotic-like cyclin 3B from Arabidopsis
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g11330

 
Sequence (A. th genome BLAST matches underlined)
>84-K012801-022-136-D11-35St
TGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTGGGATCCTACCTATAGCGAGTCGTATTACATATCGTTTCCCGCCTTC
GATCTTACTCTTTCTTTTTCTCCATATTGACCATCATACTCAAAATCCTCATCTCTTGTT
AAAATCCTTGTCACTTTCTTCTCACTATCAGTTGTCTGATTCTACAACAAACCCACAACA
CACAAAAAAAGTTAAAAACTTTAGGTAGAGCTGGAAAAACTAAACGCCGATTGTTTCAAT
TGTCGAACTAAACTCAGTGTTCTTATTACCTGAGATCCTCCCTATAGCGAGGCGAATTAC
TCAAAGAGCTGTGGAGTAGTAAGCCATGATTTGATGATCTGCCGAGCCTGAGGGTCGAGT
CCGAGCCCAGCACCAGTAGGACTCCCAACAGGAGGTTCGGAAGATTTTGGGATCCTCCCT
ATAGTGAGTCGTATTAC
GenBank Accession AL765218 [GenBank]
Graphic View Graphic view of gene At5g11330
Predicted Position of Insertion Chr5:3618445 - go to primer design
BLAST e Value 7e-120
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD/NAD(P)-binding oxidoreductase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03