SimpleSearch - Line and FST details


Line specific information

 
Line ID 136E12
Vector Used pAC161
Line Availability only available from NASC (N413020)
Segregation Analysis 50:36:31
Confirmed for Hit At5g42520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g42520

 
Sequence (A. th genome BLAST matches underlined)
>93-K012754-022-136-E12-8409
NTTTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGAAC
AATAACTGAACAAGCTAACGGAATATCAAAATAAAAGACTGGTCCATCTTTTAATCCTCC
TGCACATAGCCAATCATTAAACAGTGTCAAAAAAGACCATTTCATAAATAAACTACTATG
AAGCAAAATAGCCAATCACCAAAGCATTGCTATGGGATCCTCCCTATAGTGAGTCGTATT
ACTC
GenBank Accession AL765227 [GenBank]
Graphic View Graphic view of gene At5g42520
Predicted Position of Insertion Chr5:17001252 - go to primer design
BLAST e Value 1e-81
Hit Clone Code (BAC ID) MDH9
Hit Gene Code At5g42520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic pentacysteine 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23