SimpleSearch - Line and FST details


Line specific information

 
Line ID 136G06
Vector Used pAC161
Line Availability only available from NASC (N413038)
Segregation Analysis 160:131:115
Confirmed for Hit At2g22770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F21J6

 
Sequence (A. th genome BLAST matches underlined)
>47-K012801-022-136-G06-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGAATGGATCAATTGCTGATCCATGTAGATTATGCATGGTTA
GTGAACAATAATATTAAACCAGAAAAAGTTAATTAACATTTGTTAGATAAACTGCTTTTG
ATAACTCAATTTAGCTTTTTCTGATTATTGCTTTACTTGAGAAATAAAGAGAGGATCTTT
ACTCATCGTAAAATTTTCGATAATTTTTTTTATGTTCACTGACTACTGATTTTGTTTTTC
ATATTTATAAATGTTGAGGATATTTTGATAGAGTTAAGTATTAAATAATATAAATATAAA
GGAGAAAGGATTTATTCTACTCTGTAATATGTTTTGCGGATATTTTCTCTTATAAAACAT
ACCGTGAAAATTAAGTGTCGGAATACAGTTTGTAAAAAGAAATGATAATAATGTACTTAG
TAAAATAATATCAACCATAACTNATGGGATCCTCCCTATAGTGAG
GenBank Accession AL765246 [GenBank]
Graphic View Graphic view of sequence AL765246 of line 136G06
Predicted Position of Insertion Chr5:8773313 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21J6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g22770

 
Sequence (A. th genome BLAST matches underlined)
>47-K012754-022-136-G06-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATACGCGGGAA
GGATATAATTAGAAAAAGTTGATTAAACAATCTGCTTCAAGAAAAAGATATCCCCAGTGG
ACAGACTATAGGGATCCTCCCTATAGAGAGTCGTATTTACTGATTTGATGATCGACACTG
ACGAGTATCTGATCGATGACTGGGAATCCGATTTCCCGATATGCGGGGAAACTAACACCA
ACCCCGGTTCCGAGTCTGGATCTGGAACCGGGTTTGAGTTGCTATGGGATCCTCCCTATA
GTGAGTCGTTNTTACTC
GenBank Accession BX890774 [GenBank]
Graphic View Graphic view of gene At2g22770
Predicted Position of Insertion Chr2:9684776 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) T9I22
Hit Gene Code At2g22770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03