SimpleSearch - Line and FST details


Line specific information

 
Line ID 137C11
Vector Used pAC161
Line Availability only available from NASC (N413091)
Segregation Analysis 50:31:20
Confirmed for Hit At5g62000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62000

 
Sequence (A. th genome BLAST matches underlined)
>83-K012753-022-137-C11-8409
TTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGAAAT
TAAAGAAACCTACCTTTAAATCTACATTAATAACTCGACAGAGAAGCTTTGACGGAAGAT
CATAGAGAGGCATCTGTTGTTCTGCCGCCTGGTTCGTCGAAGCCTCCACCTAATCATAAA
ACAATGGAAACCGACAAAGTTCATTAGAAAATATCTCAACAGGTACGAATCACAGAGGGG
TTAACTCAAAGATTTAGCCAAAAATAGCAAGAACTCATAGATGAAATATCTCACCTGCTC
GATGTGTCCTTGAGGAAAATAGAAGACTCGGTCGTCTTGTCTATGGGATCCTCCCTAT
GenBank Accession AL765279 [GenBank]
Graphic View Graphic view of gene At5g62000
Predicted Position of Insertion Chr5:24911454 - go to primer design
BLAST e Value 3e-159
Hit Clone Code (BAC ID) MTG10
Hit Gene Code At5g62000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin response factor 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40