SimpleSearch - Line and FST details


Line specific information

 
Line ID 137H09
Vector Used pAC161
Line Availability only available from NASC (N413149)
Segregation Analysis 50:49:39
Confirmed for Hit At4g15740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g15740

 
Sequence (A. th genome BLAST matches underlined)
>72-K012753-022-137-H09-8409
NTGATCCATGGTAGATTTCCCGGGACATGAAGCCTTTACAATTGAATATATCCTGACTGT
TCAACGCAGGGGACTAATTCTGGGCCAAGCAACGGTCTATGGGATCCTCCCTATAGTGAG
TCGTCATTACTCAGCAAGAAACCTATACGTGAAGCTCACGACACCTTTTTTTTCATAAGG
ACCCGTCAAAGCATGTGTCTGCAACTTCATACCGCTAGCATCACCATTGACGGGCAACGG
ATAAGGCAGATTTGAGACCAATAACTGTTGCATCGGAAGTCTAACAAATCCAATCTCCTT
ATCACCAAGGAAAGGCCGGTGGCTCATCAACTCCACAAGGAGCATCAACCGCCCTTCTTG
AGCTGACTTCTCATCAATAGAAAATTTCATCATTTGATTCCACTTTGGATTTGTATAAGC
GGCAAAAGCCACCGGTGTGTTGATCCTATTCTTAACTTTTCTGTCCTTAAGAATCGCAAC
CGAAGCGTATACGTCCATGGACGAGAAGGCGTTGACATCTTCGATGTTCTTGGCGAATTT
GATCACGAGCTCTATGGGATCCTCCCTATAG
GenBank Accession AL765321 [GenBank]
Graphic View Graphic view of gene At4g15740
Predicted Position of Insertion Chr4:8965129 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23