SimpleSearch - Line and FST details


Line specific information

 
Line ID 138A08
Vector Used pAC161
Line Availability only available from NASC (N413160)
Segregation Analysis 90:68:66
Confirmed for Hit At4g35830
Parent of DUPLO pair none
Parent of pair(s) 2959, 9620

Gene hit At4g35830

 
Sequence (A. th genome BLAST matches underlined)
>57-K012752-022-138-A08-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATCCTTCACCCGT
GAACTTTAGCTATACTAGTACTATGGGAACCTTCCTATAGGTGAGTACGTATTACATAAC
TAAAGTTGAAGAAAGTTAACGAGCATCTATGGGATCCTCCCTATATTGATGTCTTATCAC
TCTAAAGGAATTACCATTATCAACTATTGCTGAAGCCACAGCTTCATGGATATCCCCCGA
GTTTCCAATGCATGTGGTGCACCCATAACCAACGATACTGAAGCCGAGCTGATTCAAGTA
CTTCTGCAAGCCACTGCAAGACTTGAAAACTCAGGACCACACAATACAAAGGATAAGGAA
ATAAATAACAAAACATTCAACGGTGTATCTGCAGCACCTCTTTGCCAAGTACTTTGTTAC
AACTCCAGAGCCTGGAGCAAGACTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession BX572186 [GenBank]
Graphic View Graphic view of gene At4g35830
Predicted Position of Insertion Chr4:16974771 - go to primer design
BLAST e Value 1e-145
Hit Clone Code (BAC ID) F4B14
Hit Gene Code At4g35830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aconitase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03