SimpleSearch - Line and FST details


Line specific information

 
Line ID 138C03
Vector Used pAC161
Line Availability only available from NASC (N413179)
Segregation Analysis 97:24:18
Confirmed for Hit At5g19650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g19650

 
Sequence (A. th genome BLAST matches underlined)
>19-K012752-022-138-C03-8409
TTGATCCATGTAGATTNTCCCGGACATGAGAGCCTTTACAATTGAATATATCCTGAAATG
AACATGGCGTAATTAAAGCCGTAATATATACAGACTTTTTAGGGAACGAGACATACACAC
TCTATGTACGCGTACGTCCTTGTGCATTGGCATCCTACCTATAGGAGAGCTCGTATTACA
TAACGTGCTTTTCCACCCAATCCTGACTCATGTCTCCCTCCCCACCAATCAGTCATGCTT
ATTATTGCCCTCCATCGTCACCTATATCCCCACCTCACCCTTTCTACGAATAGAGACCGC
TCATTTCGAGATTTAAGGAACAAGGTCAAGACAAACAGGAAGCAAAGATCGCAGTTTGGT
TCTGACCCTCTCTTTGCCTCACGTTTTAAGTCAACCGAGTCTTGGTACTGCTCTTGTACT
GAGGAAGAAGACCAACGATACTNACAACAACGTGAAGATGATGATCCTGGTCCTCTTTTT
TCTTCTA
GenBank Accession BX890775 [GenBank]
Graphic View Graphic view of gene At5g19650
Predicted Position of Insertion Chr5:6640295 - go to primer design
BLAST e Value 6e-77
Hit Clone Code (BAC ID) T29J13
Hit Gene Code At5g19650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ovate family protein 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03