SimpleSearch - Line and FST details


Line specific information

 
Line ID 138H01
Vector Used pAC161
Line Availability only available from NASC (N413237)
Segregation Analysis 100:95:73
Confirmed for Hit At4g11230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g11230

 
Sequence (A. th genome BLAST matches underlined)
>46-K028351-022-138-H01C-8409
AGACTGAATAAATACACGTTTTTGAATTTTGTCCTTTAAAGTAAAATTTGTNTTTTGTAC
TAATCAAAGGAACTACCAGAGGAAATTACCAAAGCAGAACGAAAATATAAAAATAAGTTT
GGTTTCTAAAAATACGGGTTTTAAATTATACTATATTTACGAGTTACGACACAAAAAATT
ATACTATATTTTTGTGCATGTTTTAGGTACACTTTAATTATACTTAACTCGCTGTTGTTG
TGAAATTATATATTTTTTTAAAAAAATTTAGTTTGCTTAGCATATTAAAAATATATATGA
TTTAATGTTTTGAATTTTTATATATTAATTAATGTATAATTATTATATTTGATTTTTATT
CTGTAAAATATAAAAACAATAAAATACAATTCATTTGGTTAAAATCTATATCACAACTAA
ATAATTTGAATTTGAATTGCATTTGTTTTGTTTAGTGTTCAAAACTAGAGGTATCAAAAT
GTCTCAACTCAACTCAATCC
GenBank Accession HG968756 [GenBank]
Graphic View Graphic view of gene At4g11230
Predicted Position of Insertion Chr4:6845631 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8L21
Hit Gene Code At4g11230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Riboflavin synthase-like superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL765405 [GenBank]


Last Updated on 31.08.2016 09:40