SimpleSearch - Line and FST details


Line specific information

 
Line ID 139A12
Vector Used pAC161
Line Availability only available from NASC (N413260)
Segregation Analysis 100:98:72
Confirmed for Hit At3g23810
Parent of DUPLO pair 1213
Parent of pair(s) none

Gene hit At3g16020

 
Sequence (A. th genome BLAST matches underlined)
>89-K012875-022-139-A12-8409
NTTTTGATCCATGTAGCATTTCCTCGGACATGAAGCATTTACAATTGAATATATCCTGGT
TGACTTCTCGTTCCAGAGCTCAAGCTGTGCAATCACCTGGTTGGTGAATGAGCACGACAT
CACGAAACTCGGGTGTCCAGTGGCGCATCCCAAGTTCATCAAACGACCTTCAGCTATGGG
ATCCTCCCTATAGTGAGTCGTATTACTCAACNNGNNNNTNGNCNCTNNTCNNNTNNNNAC
TNTNCTTTAACAANGAAATCGCCTGATTATCACCCTTCTCTTCTAACTGCTGATGAATAT
ACTGGAGTAATGCGATTCTTAGTAAAGCTCTCATTTTTAGATAAAGTGTTCCACTTTCTG
CAAGTAGATCGCAATGCTCTCGATGATGTCACCGGAACCCTATGGGATCCTCCGTATAGA
GAGTCGGATTACTCAATAAGAGCCTGAAGAGCACAGATTGGATCAATCTCAGGCGCTATG
ACACGAGCACCCGGGGTTTTTATTGGCTGCAACTCGCCTATATACTACNTCGCCGTGCCC
GCCGAGGACAGGCACCCTTTCAGCCATCGTAACATCAGTAGCCCTCATGAGACC
GenBank Accession AL765427 [GenBank]
Graphic View Graphic view of gene At3g16020
Predicted Position of Insertion Chr3:5438562 - go to primer design
BLAST e Value 2e-70
Hit Clone Code (BAC ID) MSL1
Hit Gene Code At3g16020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box associated ubiquitination effector protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g23810

Sequence (A. th genome BLAST matches underlined)
>89-K012875-022-139-A12-8409
NTTTTGATCCATGTAGCATTTCCTCGGACATGAAGCATTTACAATTGAATATATCCTGGT
TGACTTCTCGTTCCAGAGCTCAAGCTGTGCAATCACCTGGTTGGTGAATGAGCACGACAT
CACGAAACTCGGGTGTCCAGTGGCGCATCCCAAGTTCATCAAACGACCTTCAGCTATGGG
ATCCTCCCTATAGTGAGTCGTATTACTCAACNNGNNNNTNGNCNCTNNTCNNNTNNNNAC
TNTNCTTTAACAANGAAATCGCCTGATTATCACCCTTCTCTTCTAACTGCTGATGAATAT
ACTGGAGTAATGCGATTCTTAGTAAAGCTCTCATTTTTAGATAAAGTGTTCCACTTTCTG
CAAGTAGATCGCAATGCTCTCGATGATGTCACCGGAACCCTATGGGATCCTCCGTATAGA
GAGTCGGATTACTCAATAAGAGCCTGAAGAGCACAGATTGGATCAATCTCAGGCGCTATG
ACACGAGCACCCGGGGTTTTTATTGGCTGCAACTCGCCTATATACTACNTCGCCGTGCCC
GCCGAGGACAGGCACCCTTTCAGCCATCGTAACATCAGTAGCCCTCATGAGACC
GenBank Accession AL765427 [GenBank]
Graphic View Graphic view of gene At3g23810
Predicted Position of Insertion Chr3:8588185 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) MYM9
Hit Gene Code At3g23810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-l-homocysteine (SAH) hydrolase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Rocha et al. 2005, sahh2-1]


Last Updated on 31.08.2016 09:40