SimpleSearch - Line and FST details


Line specific information

 
Line ID 140G03
Vector Used pAC161
Line Availability only available from NASC (N413419)
Segregation Analysis 150:125:78
Confirmed for Hit At5g66220 At4g29660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g66220

 
Sequence (A. th genome BLAST matches underlined)
>23-K012876-022-140-G03-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTAAAA
TAATTCAATGTGAGTTGAATATCTAATCATTTAACTTTTTTAAATTTTCTTCTCTGGTGG
GAAAAGGTGAGTTTGAGAAATTGGCAAGGGTGACGATGAAAAAGAGGTTAACGGGGATAC
AATACTCGGAGAAAGTAGTAGAAAACTGTGAGGAGATCATGAAAGCGTCAGGGAAATACA
CAAGATCCGAAGCCAAAGCCATTGACCAATTCTTGATGGTCTTCAAAAACCAAGATTTCC
CTCCCGGCTCTTCAATCATCTTCGCTATCTGTCCTAAAGGCTCTCTCACAGTGAGTCAAC
TTTATTTTTCGGATTATCATTTCGAATAATATTGGTCGAATGAATGATCGAGATCTTTTG
ACAACTTGTGATGCAGATTGCATTTTCGAAAGAGGAGAGAGTCCCGAAAACTGGAAAAGC
GGTTATCAAGAATAAGTTGTTGGGTGAGGCAGTTCTTGAGTCGATGATAGGGAAGAATGG
TGTATCCCCTGCGACAAGGGAAAGCCTCGCTGAGAGATTATCTAAGCTGATGAACAAAAA
AAACCCGTACAACGAAACTAACGTCAACGGTTGCTACAAAAATTGAAACTATTTCCACTC
GCCCAATCTTGATAATTTTAAAAAATGAAGCCCGCGGAGGATGGTATTTGACTTATGATT
ACACCCTAAATAAAGATTGTTGGACCTTATTAAAAACATTTTTATGTTTTTA
GenBank Accession AL765560 [GenBank]
Graphic View Graphic view of gene At5g66220
Predicted Position of Insertion Chr5:26461587 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K2A18
Hit Gene Code At5g66220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g29660

 
Sequence (A. th genome BLAST matches underlined)
>23-K012893-022-140-G03-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTAAACATGGTCTTAGTATCTAATCTAATTCATTGTTCTGTAG
TATATTGTATTCTTTGTCAATGTGTTTCTTACACTGTTTTGTGTTAGTATCAGTTATGTT
TCTTGTTTGAGTGTGAACTTTATGTTACTCCACTCTCTGTAAACAGGAGAAGTTTTGGGA
AGAGCACCCAGGGAAAACAGTGCCTCTGATGAAGCCAGTATTCTATCGAGGACCATGGAG
AGTTTATCGTGGTGAGGCTATTGCTTCAGATGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX285162 [GenBank]
Graphic View Graphic view of gene At4g29660
Predicted Position of Insertion Chr4:14534751 - go to primer design
BLAST e Value 1e-136
Hit Clone Code (BAC ID) T16L4
Hit Gene Code At4g29660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation embryo defective 2752
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40