SimpleSearch - Line and FST details


Line specific information

 
Line ID 142A03
Vector Used pAC161
Line Availability only available from NASC (N413539)
Segregation Analysis 50:24:19
Confirmed for Hit At1g13260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g13260

 
Sequence (A. th genome BLAST matches underlined)
>17-K012878-022-142-A03-8409
TTGATCCATGTAGAATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAGAAA
TGAAGATGTCCGGATCTGACGCTCAGTGGCAACGAAAACTCACGTTAAGGGATTTTGGTC
ATGATATTATCAAAAAGGATCTTCACCTATGGGATCCTCCCTATAGTGAGTCTATTTACT
CATACTATAATTACTCCCCTCAAACACGCATTCTTACAAATATATTTTTTGTTATTACCA
AATAAAAAGTGAAACATAAAATAATAATATCAGAAGTGACACTTGCTGTTTCTTATTTCC
CTCCCCCCAAGCTCTTTCTCCTTCTTTCTATATATATTATACACACACACGTATACATAT
ACACAACATAATTCACAACACAACACAAACACATTTCTGTTTTCTCCATTGTTTCAAACC
ATAAAAAAAAACACAGATTAAATGGAATCGAGTAGCGTTGATGAGAGTACTACAAGTACA
GGTTCCATCTGTGAAACCCCGGCGATAACTCCGGCGAAAAAGTCGTCGGTAGGTAACTTA
TACAGGATGGGAAGCGGATCAAGCGTTGTGTTAGATTCAGAGAACGGCGTAAAAGCTGAA
TCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX649715 [GenBank]
Graphic View Graphic view of gene At1g13260
Predicted Position of Insertion Chr1:4542003 - go to primer design
BLAST e Value 3e-97
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation related to ABI3/VP1 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03