SimpleSearch - Line and FST details


Line specific information

 
Line ID 142B04
Vector Used pAC161
Line Availability only available from NASC (N413552)
Segregation Analysis 50:34:24
Confirmed for Hit At5g46340
Parent of DUPLO pair none
Parent of pair(s) 871, 78474, 78475

Gene hit At5g46340

 
Sequence (A. th genome BLAST matches underlined)
>26-K012878-022-142-B04-8409
TTTGATCCATGTAGATTTCTCTGACTGATAGCCATTTACATCGAATATAGTACTGTGCGC
TGACATATTTTCATTCGCGTTTATGGAAGGGACTCAGCTGAATTGTATTCTGACCTATAG
AGAGTCAGATATCGAACAAGTTGCAGAGCCTGTGCAAGTAGTATTCCTGTCAATGATGGA
TATGTTACCAACCCTTACCTGAAACTTTTATGTTACCATTTTTTGAACTATGGGATCCTC
CCTATAGAGAGTGGTTTGACTCAGGAGTAATTGGTCCAGGATCCACCATTTTTAACGATC
TCTATTCAAAACTTCCGAACTGCAGACACACCAAATAAGAAGAGCAAATTTATGTAAATC
GAAAGAGAAATTTAAAAGAAACCATTCAGAAAAATTTCAGAAGCAAAATCTTAAAGATTT
GAAATTACCAGAGAGAGATTGAGACGTTAACCGACGAATAAAGAAGATGATCTGGTTATA
GTGATCTCTATGGGATCCTCCCTATAGTGAGTCGTTTAACTC
GenBank Accession AL765666 [GenBank]
Graphic View Graphic view of gene At5g46340
Predicted Position of Insertion Chr5:18799495 - go to primer design
BLAST e Value 3e-125
Hit Clone Code (BAC ID) MPL12
Hit Gene Code At5g46340 [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-acetyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770214 [GenBank]


Last Updated on 14.10.2014 10:23