SimpleSearch - Line and FST details


Line specific information

 
Line ID 142C11
Vector Used pAC161
Line Availability only available from NASC (N413571)
Segregation Analysis 100:78:71
Confirmed for Hit At2g32460
Parent of DUPLO pair none
Parent of pair(s) 52776, 89495

Gene hit At2g32460

 
Sequence (A. th genome BLAST matches underlined)
>83-K024348-022-142-C11t-8409
CGGACAGAAGCCATTACAATTGAATATATCCATGTATGATGAATTATTGACGAGCCTTCT
CAACAACTTCCCTTCAACCACAACACCTTTGCCTGATTGGTATCGGGTGACAGAAATGCA
AAACGAGGCCTCATATCTTGCCCCACCAAGTGGAATTCTTATGGGAAACCATCAAGGTAA
CGGCAGGGTGGAACCACCCACGGTGCCGCCTTCGTCCAGTGTAGATCCTATGGCCTCGTT
GGGGTCATGCTATTGGAGCAACATGCCTATGGGATCCTCCCTATAGTGAGAACATGATAT
GCAATTCCTTTATAATGCTCAGCTCCTCAATCTCAGATGCATTAGAAACACCACAACTAA
CCGCCTTCTCTCCCGCCCTCACTATGGGATCCTCCCTAAGATGAGGAACGAGGGGCAAAA
CAGAGATAATTAGGCGGAAATAAAAATGGCGGAAAACCCACAGCCACGACCTAGATGTAT
AAAGGAGGGA
GenBank Accession BX890800 [GenBank]
Graphic View Graphic view of gene At2g32460
Predicted Position of Insertion Chr2:13782663 - go to primer design
BLAST e Value 1e-129
Hit Clone Code (BAC ID) T32F6
Hit Gene Code At2g32460 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 101
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23