SimpleSearch - Line and FST details


Line specific information

 
Line ID 142H11
Vector Used pAC161
Line Availability only available from NASC (N413631)
Segregation Analysis 50:47:37
Confirmed for Hit At1g65930
Parent of DUPLO pair none
Parent of pair(s) 69079, 97377

Gene hit At1g65930

 
Sequence (A. th genome BLAST matches underlined)
>88-K012878-022-142-H11-8409
NTTTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTCG
TCACTTCTGGGTTCATCAGAAAGGTGGTGAGACCAGCACAAACTGCATAGCCTCTATTTT
TGCTTGGACTCGTGGACTTGCGCACAGGTAACAAAAAGAAAACATGCTTAATAATGTTTC
ATTAGAAGGAAGAGGATTGTCTAAGCTAATGTCTTTGAAACAGGGCTAAGTTAGATGACA
ACGCAAAACTCTTGGATTTCACTGAGAAGCTGGAAGCCGCTTGTGTTGGGACAGTGGAGT
CAGGGAAAATGACCAAAGATCTTGCACTCATCATTCACGGCTCAAAGTAATCAATTCAAC
ACTTTCTATTTACGTCCTTGTTCTCATCAAGATCACTTAATTTACTGTCGGATTTTTTCA
GGCTTTCGAGGGACACGTACCTGAACACAGAGGAGTTCATCGATGCAGTCGCTGCTGAGC
TCAAAGAAAGACTCAATGCTTAAGAAACTGAAGAAATTGGGTAAAATTCGAACGTCTCAG
TTCCTAAGTGTCTTATCTGGTTGGTGGGGGTNGGGNTGGGATTNGGGAGGAATAAAACTT
TTGTGGAGAGGAGTGGTTGAGAACCGATTTGTTTCCTCTCTTATAATATTTTCCAAAATA
TGGCGACATTTTT
GenBank Accession AL765734 [GenBank]
Graphic View Graphic view of gene At1g65930
Predicted Position of Insertion Chr1:24541417 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F12P19
Hit Gene Code At1g65930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytosolic NADP -dependent isocitrate dehydrogenase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40