SimpleSearch - Line and FST details


Line specific information

 
Line ID 143A02
Vector Used pAC161
Line Availability only available from NASC (N413634)
Segregation Analysis 50:48:46
Confirmed for Hit At1g25580
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g25580

 
Sequence (A. th genome BLAST matches underlined)
>09-K012977-022-143-A02-8409
NCTTGATCCATGTACGATTTCCCGTACATGAANGCACTTACAATTGAATATATCCTGCTT
CTATAGAGACTTGTCTATGGGATCCTCCCTATTTCGAGTTGTATTATCTCAGGTGTATAA
ACGAGATAGGGCTTGAGACAGGATGGAGGGAACGATAGTGGTACTATGCATAGTGCGATA
TACACTACGACATGGAGATTTTAGCATGAGGCTCTGCACCCTAAGTACGATTCCTGACGA
TTTCAATTGCGACAGACAAACTCAAGGGGCAAACTTATTGTGTTGGCGTCTATATATCAA
AAATGAACTATGTGATTTCAATTTCTCCGATGTGAAAGTTAAGCGCGAAAGGGGTTAATT
TGAAAATCTGCATTTGGGTCTTTCACTGCTATGGGATCCTCCCTATAGGGAGTCGATNTA
CTC
GenBank Accession AL765738 [GenBank]
Graphic View Graphic view of gene At1g25580
Predicted Position of Insertion Chr1:8999680 - go to primer design
BLAST e Value 7e-55
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC (No Apical Meristem) domain transcriptional regulator superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03