SimpleSearch - Line and FST details


Line specific information

 
Line ID 143C01
Vector Used pAC161
Line Availability only available from NASC (N413657)
Segregation Analysis 50:48:45
Confirmed for Hit At4g32800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g32800

 
Sequence (A. th genome BLAST matches underlined)
>03-K012977-022-143-C01-8409
TAAATGTCCAAATTAAACCAAGGAATACTAATCATAGATCTAATAAAATACTTGTTTTGG
GCCTACTGGGATCCTCCCTATAGTGAGTCTTTATACTCATTTAATCATAGACCCATCTTT
GGCTCTATTAGATATCTTATACGCTTACTCTGATCCCAGAGACTTCCATTCGTTTACATT
AAAACCTTATCTGGTTAGATTGATAGTGAAATTTTGGGTTTTTTTTTTACTACTGGAAAC
CGTTTTCAAGATTCTAAAACTGAGGAGCATTGCAACGAATAATGGTTGTTATTATACGTT
TAAACTTCTTCTTCCGTGCCCCTTAACCACCGAGGCATGTGCACCACATCCTACAACGAG
TCAATATCTCGAACTCGTTCGACTCGTTTAGGCTCGTTCCTATGGGATCCTCCCTATAGT
GAGTCGTTTTACTC
GenBank Accession AL765764 [GenBank]
Graphic View Graphic view of gene At4g32800
Predicted Position of Insertion Chr4:15820739 - go to primer design
BLAST e Value 4e-41
Hit Clone Code (BAC ID) T16I18
Hit Gene Code At4g32800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40