SimpleSearch - Line and FST details


Line specific information

 
Line ID 143D07
Vector Used pAC161
Line Availability only available from NASC (N413675)
Segregation Analysis 100:68:52
Confirmed for Hit At1g16780
Parent of DUPLO pair 2436
Parent of pair(s) none

Gene hit At1g16780

 
Sequence (A. th genome BLAST matches underlined)
>52-K013023-022-143-D07-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGATGCACCAAAACCATATCCCATAAGATTCGGTTTAAATGG
GGATCATCATTTAACTACGTTTGCTAATGTATCTTTTAAAGAGGTACATTTTTTACTCTT
TGGTGTATTCTGTTTCCTCTTATTCCATTCCACTCGCATACTCATCCTGATTCTTGTCCT
CACATCTAAACAGGTTGATATTGCGATCCCAGAAGTCTTCATTGGAGGGTTATTAGGTGC
CATGCTTATATTCCTGTTTAGCGCTTGGGCTTGTGCAGCAGTTGGTCGAACTGCACAGGA
GGTTGTCAACGAAGTAAGAAGACAGTTCATTGAGAGGCCTGGCATAATGGTAAATGTAAT
TCCGCTGGAGTCCGTTCCCTTTTATTTTTATTTTTTTCATCGGGTGTCTTTTTGAACTTT
ATGTCACAGGACTACAAGGAGAAGCCAGATTATGGTCGATGTGTCGCCATTGTCGCATCT
TCAGCTTTGAAGGAAATGATAAAACCAGGAGCTTTGGCTATAATATCACCCATTGCAGTT
GGGTGAGTCAGTAAAAATGTTGGGTTAAACCCCGTGGAAACGAGAAAAAACAGGACATAA
GGGAACCAACGCTTTCTATTTTGATGTCCACAGGGTTTTTGGGGTTCGGGATCTTGGGAA
TCCTACACTGGGAAACCTTTTGCCTTGGAGCTAAAATAATAACTGCAATGCTTAAGGTTG
CGACAGTATGGTGGAATCTTAATGGGTCTATCCTAAATACAACCAGAGGTGCCTTGGACA
ATGCAAAGAATACATTGAGACTGGA
GenBank Accession AL765783 [GenBank]
Graphic View Graphic view of gene At1g16780
Predicted Position of Insertion Chr1:5740508 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17F16
Hit Gene Code At1g16780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Inorganic H pyrophosphatase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03