SimpleSearch - Line and FST details


Line specific information

 
Line ID 143E09
Vector Used pAC161
Line Availability only available from NASC (N413689)
Segregation Analysis 50:23:15
Confirmed for Hit At1g59870
Parent of DUPLO pair none
Parent of pair(s) 1136, 4475, 4508, 4600, 10030, 73631, 73643, 73666, 73674, 73685, 73690, 73694, 73698, 73699

Gene hit At1g59870

 
Sequence (A. th genome BLAST matches underlined)
>69-K013023-022-143-E09-35St
CTGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGGAATGTACCGAT
AGGGTCTGCTCGGGTTCACCCAGTACTGTTCTTGATCTTTCTTGGAAGTAACCTCTTGCA
GGAAATCAGCTGTTCCTTTTCTCTCAGGACACTTGAACCCAAAGCTCTCAAAGAACTCAA
GAATGTTGTCTCTCGGTCCTTGGTACACGATCTGACCTTCCGACACCAAGATGATATCAT
CGAATAAATCAAAAGTCTCAGGAGCAGGCTGGAGGAGAGACATGAGCACCGTGGCTTCAT
TGAGGTGAACGATTTGTTGCAGACACTTGACGATTTGGAAAGTAGTGGAACTGTCAAGAC
CAGTGGATATTTCGTCCATGAAGAGTGTCTTAGTAGGTCCAACAATCATCTCACCAGTTG
TGACACGTTTCTTCTGACCTCCAGATATACCTCTCATCATGTCATCTCCAACTATTGTGT
CTTTGGCAATGTCAAGCCCCAAAATCTGTTACACGGCCAAAGTTAGTATTATACAAAAAA
AGACTCANAACTTTATGAACATGAGAAAAGATTGTCTATGGGGATCCTCCCTATAGTGAG
CGTATT
GenBank Accession AL765794 [GenBank]
Graphic View Graphic view of gene At1g59870
Predicted Position of Insertion Chr1:22036446 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F23H11
Hit Gene Code At1g59870 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC-2 and Plant PDR ABC-type transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23