SimpleSearch - Line and FST details


Line specific information

 
Line ID 143E10
Vector Used pAC161
Line Availability only available from NASC (N413690)
Segregation Analysis 50:21:17
Confirmed for Hit K9D7 At5g43660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit K9D7

 
Sequence (A. th genome BLAST matches underlined)
>77-K013023-022-143-E10-35St
CTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGAAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCAGTGTTTGGTAAATTCGTTGGGAAAAGAGGAGAAAGTCAAACTGAT
TCATGAGAAGTTAAGAAAGCCCAAGCCCATTAAATTGAGTATCACTTAATTCGTTATTTA
TACTAAAAAAGATCGTTTTCTATGGGATCCTCCCTATAGTGAGTCTTATTAC
GenBank Accession AL765797 [GenBank]
Graphic View Graphic view of sequence AL765797 of line 143E10
Predicted Position of Insertion Chr5:17535626 - go to primer design
BLAST e Value 8e-61
Hit Clone Code (BAC ID) K9D7
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g43660

 
Sequence (A. th genome BLAST matches underlined)
>77-K012977-022-143-E10-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGATAGT
TTAAACCGAAGGCGATGTCACAAGAATACAGTAATTCTCCATCATGTATAAAAGTTACAA
GAATTGTATAAGGAGATGTCTCAGTCTCATAGGTGTGTATAGTTTCCTAATGCTTTCACT
TATAGTTCACGTATCAACGGGTTTTGCCTGAGTTTGGAAACTTTCTTTTATCCCATTGGA
CAATTACAGTAGTGTTCACAAAGATCAAAACCTTTCTGTATAACAAATCAGGTCCAAACC
AAATCATACATTTAGAATTTCCATATCAATCTATAAGATTCAGAAAACCTGACAATATAA
GGTGTAGATAATGACTAAATACCAATATTAATTGTTTGTATAACCCAATTAGTCAAAACC
ATTACCTGTACCGATTAAAATCCAAACCAATTTTACAGGTTTGCTGCCACATTTCCTATG
GGATCCTCCCTATAGTGAGCGTNTTAC
GenBank Accession AL765796 [GenBank]
Graphic View Graphic view of gene At5g43660
Predicted Position of Insertion Chr5:17538656 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K9D7
Hit Gene Code At5g43660 [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23