SimpleSearch - Line and FST details


Line specific information

 
Line ID 144E08
Vector Used pAC161
Line Availability only available from NASC (N413784)
Segregation Analysis 50:27:19
Confirmed for Hit At3g09520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09520

 
Sequence (A. th genome BLAST matches underlined)
>61-K013024-022-144-E08-35St
CTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTAATGAAAAATATGTTTGTTGCGTAACAATTTTGGCATGA
AAGGTTAACTACTAATTAATTAGTGTTTGCTTTTACATTTAAGACGATTATAGACTCTCC
TTCACTTTAGGACATGGATTGCCTTGACCGACAAGAGGAAGGAGAAGAGGCTGACGAATT
CCCCGAACTACCCTTCTCTCTGAACAAATCAGACAAATAGTTTTCAATATCTTCAGGGGT
AAATCGGACAACTGAGTTCAGGTTTCTCGCGCCATCGCCTTCTCCCAAGATAACAGAACC
TCTCGTGTTGTAAAACTCGCGATAGATCGGCACCAGCTTTCTCGATATCGATACTTTGAT
CTCGTCTCGTATATTTGGATCAGCTACGACGCAGACACTGTGCTTACTATACGCGTTTTC
GAAGCTCTCGCTGAATTTTTCAAACCGCTCCTTCACTTCCTCCGGCGTCATCTCCACCGT
ACGATTCTCAAGTAAAGTAGCAACCACCGGTCCCCAAGCTATGGGATCCTCCCTAT
GenBank Accession AL765883 [GenBank]
Graphic View Graphic view of gene At3g09520
Predicted Position of Insertion Chr3:2925734 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11F8
Hit Gene Code At3g09520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein H4
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23