SimpleSearch - Line and FST details


Line specific information

 
Line ID 144E08
Vector Used pAC161
Line Availability only available from NASC (N413784)
Segregation Analysis 50:27:19
Confirmed for Hit At3g09520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09520

 
Sequence (A. th genome BLAST matches underlined)
>61-K012978-022-144-E08-8409
TGATCCATGTAGATTTCCCGGACATCACATACTAAGTGAAGATAGCTATGTTTTATTTTT
TATTTTTCCTTACAGTTTAAGGTAAAAATCTTCGGGTTTCTATTTCGAACATTATGTCAC
ACATTTGTCTGTAATGTTTAATTAATGATATATCTATAAAAAGATCGTCATGTTTCTCAT
TTTTCAAAAATGTATTTGTAAGTAAGAGACACGTGTACGGAAAAGATGAGTCAAAGGCCA
ACGGCACATTCTTCCCCATATTTCGCTGACGTTGTTTTGTAACCATAACGATAAACGACC
TAAATCTTTCATTATGGTTGCGTAACAGATTAAAAATATCTACAGTTTCTGTTCTAACGT
AACGACGCCTCCCTGCATTTGGATTAAGTGGTAGGTTCTTTAAAAGGGAACCCTTTTCAC
CACTATGGGATCCTCCCTATAGTGAGTCGTTTTACTC
GenBank Accession AL765882 [GenBank]
Graphic View Graphic view of gene At3g09520
Predicted Position of Insertion Chr3:2925798 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11F8
Hit Gene Code At3g09520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein H4
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL765882 [GenBank]


Last Updated on 31.08.2016 09:40