SimpleSearch - Line and FST details


Line specific information

 
Line ID 145B10
Vector Used pAC161
Line Availability only available from NASC (N413846)
Segregation Analysis 100:30:5
Confirmed for Hit At2g23760
Parent of DUPLO pair none
Parent of pair(s) 3362, 9726

Gene hit At2g23760

 
Sequence (A. th genome BLAST matches underlined)
>74-K012979-022-145-B10-8409
NTTTGATCCATGTAGAATTTCCCGTACATGAAGCTCTTTACAATTGAATATATCCTTGTT
AACATCCGCACCTTGCTCAGAAGATACTTTACCATCTCAATGTTCTCTTCGCATACAGCG
GTATGGAGCGCAGAGGTGCCTGTGGCTCTATGGGATCCTCCCTATAGTGAGTCTATNTAC
TCAATACTTATCATACAAGAACCCTTTTAATTACTCATTTACATATATGTACTTAACTCA
CAATTTACCATATATATCAATCATTTCATCATGCAAAATCTGACATGAGTGGCTTCATGT
CTATTCTCTTGCATGGATTTTCAATATCACGAATCATTTGTTTTTCTTGGGGTTCGTTTT
CTTCATTAAATACATTATCTACACTTACACACACAAGGATATATAAAACATAGGAGAGAG
AGATGTAAGTATTTCTCAAGTACATGAAAGTTTGAAGCTTTCATTTCAATGTTAACTATG
GGATCCTCCCTATAGTGAGTCTATTA
GenBank Accession AL765933 [GenBank]
Graphic View Graphic view of gene At2g23760
Predicted Position of Insertion Chr2:10109468 - go to primer design
BLAST e Value 7e-166
Hit Clone Code (BAC ID) F27L4
Hit Gene Code At2g23760 [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23