SimpleSearch - Line and FST details


Line specific information

 
Line ID 145C05
Vector Used pAC161
Line Availability only available from NASC (N413853)
Segregation Analysis 100:83:58
Confirmed for Hit At3g03200
Parent of DUPLO pair 2687
Parent of pair(s) none

Gene hit At3g03200

 
Sequence (A. th genome BLAST matches underlined)
>35-K012979-022-145-C05-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAAACCCT
TGATAATGAAGACGTGAATACAAATGAAACCCTTGATTCATCGGGATTCGAGGTGGTTGA
AGANAGAACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNCTNTN
NGGNGGNNNNNNTNNNNTNTTNTTCTNCTCTTNNNNTTCTTTTANNTTNTGGTTTTTTTT
GTTTTCCNTNTTCTTTNNTCNGGNTTTCTGGNTCTTCTTCCTTGTTNNNTGGCTTCTGTG
CGGGCCCTCTCCTTGGTTCTGCGTTGCCTTTGTTTGGTCCTGGTGGCGTCCCCCCCCCGT
GCTCTCTCCTCTTTTTCTTCTC
GenBank Accession BX572190 [GenBank]
Graphic View Graphic view of gene At3g03200
Predicted Position of Insertion Chr3:736461 - go to primer design
BLAST e Value 9e-27
Hit Clone Code (BAC ID) T17B22
Hit Gene Code At3g03200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 45
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40