SimpleSearch - Line and FST details


Line specific information

 
Line ID 145E02
Vector Used pAC161
Line Availability only available from NASC (N413874)
Segregation Analysis 50:43:34
Confirmed for Hit At4g33060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g33060

 
Sequence (A. th genome BLAST matches underlined)
>13-K012979-022-145-E02-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTACAG
CAAGAAAGTTAAAGAACTGTACGCTTCATTACATATAGCAACCACGAGGAACTCTCCACT
ATGGGATCCTCCCTATAGTGAGTCGTATTACGTATACTATCTGTGCGAGAAGCTCTGAAT
GCTAAGAAAGAAGCGGCTCAAAAAGATAAAAGCTTTTCTGTATCTGATACAGTTGGAAAT
AGTGATGATGACGATGATGGTGAAGATGAGACTAAATTTGATGCAAAGATGAGGAATCAA
GTGCTCAGCAGAAGGAAGGAGATTGGAGATACGCCTTCAAAGCCGACTCAGAAAAAAAGT
AGTTACGTTTTCCATCTCTCTATATCCTGATATCCTGAAATATTAAACTTATGGCAATTC
TTGATTTGAATAATCGAATCTTCAATCATATTAAGCAATCATGTCTATGTTTAGGGATGT
TATCTGTTTATCAACCCGATTTGATGCTTTTAGGTTTGGCACCAAGTTTTGCCCGACATA
ATAATCCGGTCTCTCCTCATGCGGGGCTTTTACATTATCTCTA
GenBank Accession AL765957 [GenBank]
Graphic View Graphic view of gene At4g33060
Predicted Position of Insertion Chr4:15949979 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26P21
Hit Gene Code At4g33060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23