SimpleSearch - Line and FST details


Line specific information

 
Line ID 145H10
Vector Used pAC161
Line Availability only available from NASC (N413918)
Segregation Analysis 50:30:24
Confirmed for Hit At1g21770
Parent of DUPLO pair none
Parent of pair(s) 609

Gene hit At1g21770

 
Sequence (A. th genome BLAST matches underlined)
>80-K013025-022-145-H10-35St
ACTGGCGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCAGTGTTTAACGAAGATCGTGTGGAACGAAGGAAGACATAGATTCGA
GACTGATGATCACGAAGCCTTCATAGAGTACAAGATGAAGAATGACGGTAAAGTCATGGA
TCTGGTTCGAACCTTCGTACCGCCGTCAAAAGCAGGACTTGGTTTAGCTTCGCATCTATG
CGTCGCCGCTTTCGAACACGCCTCTGAACACTCTTTCTCCATCATCCCCACTTGCTCCTA
CGTTTCCGTATACATCTCTTCTTTCCTCAAAAAATTGAGATGAATCAGATTCTTATGAAA
ATATGTCGTGTTTTGCAGGAAACGTTTCTTCATCGAAACCCAACGTGGCAGCGTCTGGTT
CACTCAGAGGATGATTCCAAGAACCTCAAGTCTATGGGATCCTCCCTATAGTGAGGTTTT
ACCTCTCAANNNNNNNNNNNNNNNNNNNNNNNNNTTTTNTTTTTNNNNNNNNTNNTTTTT
TNNTNGGGGTNTTTTTTTTNNNNNNCCTTTNNNNNNNNTTCCNTTNNCCCTNNTTTTTTT
TTNNNTCCCCCCTCCCTTNCCCCCCCCTTCCCCTTTTNTTTTTCCTTNNNNNCCCTTCCC
CCCNNNCCCAACTTTTTTCTTTNNNTTTTTTTTCTCCCATTTTTTNNNNNAAAAANAAAA
TTTTCCCNACATTTANAACCATTTNNNNTTTAATTTAAAAAAAACACTCTCCAAACTTTT
TTTAACCCCCAANAATCCAATAACACTCTTCTTTAACCCCCCCAAANNCCACCAAACCTA
ACTTACCCCTTTCTTCTTTTATTTTTAA
GenBank Accession AL766000 [GenBank]
Graphic View Graphic view of gene At1g21770
Predicted Position of Insertion Chr1:7652221 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8K7
Hit Gene Code At1g21770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Acyl-CoA N-acyltransferases (NAT) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23