SimpleSearch - Line and FST details


Line specific information

 
Line ID 145H10
Vector Used pAC161
Line Availability only available from NASC (N413918)
Segregation Analysis 50:30:24
Confirmed for Hit At1g21770
Parent of DUPLO pair none
Parent of pair(s) 609

Gene hit At1g21780

 
Sequence (A. th genome BLAST matches underlined)
>29-K118873-0022-145-H10C-8409
TTTACATTGTTTCTCTAGTCTAAGTCCACTCTCTTTCATTTCAAACCGAGAATTGATTTT
AATATATCGTTAGTAAACCGGTTTAATGGATAAAAACGTATAATCGTCGTACACGTGGCA
GGCGATGGAGGCGGCAGAGTGTTTTGCTTGCTTCGTCGTGTTATTTGGCGTGAAGTAAAG
AGTTCAGAGAGAAAAGGAAGTCAAAACTTCAGAGAGAAAGTGGATGGGGGACACGAAGGT
AGAGACAATCTCGAGGTTAGCTCAATGGAGAATTGAAAATTTTGGTCCTTGTTCTTTCAA
AAAGTCCGATCCTTTCAAAGTCGGAATTTGGAATTGGTAAGCTTTTCATTTTTGGTTTAT
TTTGGTAAATTTTCTTCGGAATTTTGATTTTTGTTTGTTTTGGGATATGATGAAGGCATC
TGTCTATAGAGAGGAATCGCTATCTATCAGTGAGGCTATTCCCAGAACTTTCTCGAGTAT
CTAAAGAGCAACCTCCTGTTGCCAAATTTGTTCTTCGTGTCTCCAACGTTGGCCCCAATC
GTAGATTCTACATCTCTCCTGGTATGTCTTGTCTTTGAATTGACTTTTCTGGATTTGGAA
TTTGAATTCTATTGTCGAGCTCGAATTAGGTATTTCAGGAAAGGGAATTACCTTTTATGT
GGGAACTATATTCAATTATGTGGAATCTGAAAGATATTAATTTAGATGTTAATGAT
GenBank Accession HG968775 [GenBank]
Graphic View Graphic view of gene At1g21780
Predicted Position of Insertion Chr1:7652263 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8K7
Hit Gene Code At1g21780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BTB/POZ domain-containing protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968775 [GenBank]


Last Updated on 31.08.2016 09:40