SimpleSearch - Line and FST details


Line specific information

 
Line ID 146E09
Vector Used pAC161
Line Availability only available from NASC (N413977)
Segregation Analysis 50:27:22
Confirmed for Hit At3g06010
Parent of DUPLO pair 2410
Parent of pair(s) none

Gene hit At3g06010

 
Sequence (A. th genome BLAST matches underlined)
>69-K012980-022-146-E09-8409
NTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAAAAGCCTGTTTAAATATCGTT
GTCAGCTATGCAACCATCCAATGGGTTGTCTCGCATTAATTCCTCTGTGAGATGCAACTG
CTTCTGTATTAGGTTTCTTTTACTCTAAACAAAGCATATACTGATAAGCTGCTTTGATGT
CGCATAGGCAAAAAGGCTGATTTTACTACATAACATCATTACCAGAGCAATTTATCAAAA
CCAAGAGAAATCTTGCATGCAACTTCCCTGGGTACCCATGCCGCTAACTGAAAAACACAT
TTTGGTAGCACAGCTTTTGGAGCAACTATAAGATAAGGCCCAGGCACACCTTTATTCTCC
AGAGGATACGCAATCAGAGAAATTGCCTGAATAGATTTTCCCAAACCCATCTGAGTACCT
AATATTCCATTGAGGTATTAGTTGAATAGAGAAACCATCCATTGAAGCCCTTCTAATTGA
TAGGATCGTAGTTCCCCACCTTCTATGGGATCCTCCCTATAGTGAGTCGTTTTACTCAAN
CNNNNCNNNNNNNNNANAANNNTATATCCCCACAACCCTACTCTTATTCGCATAATACCC
ACTACCCTTCCTTAACTAACACCCCACCAATACCCCCAAAAATTTTTGTTTTCTATCCCC
GenBank Accession AL766055 [GenBank]
Graphic View Graphic view of gene At3g06010
Predicted Position of Insertion Chr3:1804568 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) F2O10
Hit Gene Code At3g06010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeotic gene regulator
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03