SimpleSearch - Line and FST details


Line specific information

 
Line ID 146F12
Vector Used pAC161
Line Availability only available from NASC (N413992)
Segregation Analysis 50:30:22
Confirmed for Hit At5g60450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g41762

 
Sequence (A. th genome BLAST matches underlined)
>94-K104555-0022-146-F12-8409
TACATTGAAATGTCTGAGGAGACACCGAGTGCCAAAAAAAAAGAAATACTTGGAATTTGA
AAATTCTTTTTGGCATGCATCATAAGGATACTAAATCCTATTTTCTGGTAAATTTTCATA
ATTTTTTGACACCTCTATGGGATCCTCCCTATAGTGAGACNTTTTACTCCCCCATTTAAA
CGCGATTCGAAACTCGGCGTTGAAGCCTTCAGAGGATGGGCCATGGAAGACCCCCTGACA
AGAGGCTTTTGAAGGAGGCAATTAAGAGGTATATTGAAGAATCACAGTGAGATATACGGC
ATGGTGAGTGTATGATAAAAAGGGATTGATAGGTATGACGAGTAGAGCGGAGAGAGGAGA
GCAATATAAGAGATGAGAGGATAAGGGAAAGATTGTAGCTGGTGATATAGAAAGAATGTG
GTGGAAGACTAACAGTAGATATGAGATAGTGGGAGTATATGGAGAATCAAGAGTAATGAG
ATACGAAAAAGATAGAAAAAAAGGAAAAAGAGAGACGAGTAGAGATGGCAAGTAGAAATG
GGTTTGGGAGTATGGAATGAGAGCTGGGATAGAAAAGTGAGAAGGACCAGCTGTGGTTGA
AAACAGAAGAAAATAGGAGGACAGACGGGGAGGAAGTACAAAGAGACGGAAGATATTAGA
GGAGAGCGAGAAGGAAGG
GenBank Accession FR804392 [GenBank]
Graphic View Graphic view of gene At3g41762
Predicted Position of Insertion Chr3:14195872 - go to primer design
BLAST e Value 4e-45
Hit Clone Code (BAC ID) F21A14
Hit Gene Code At3g41762 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR804392 [GenBank]

Gene hit At5g60450

 
Sequence (A. th genome BLAST matches underlined)
>94-K013026-022-146-F12-35St
NACTTGCGTAAGGGATGACGCACANTCCCCTATCCTTCGCAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTGATATACTCTTGTATTAGATCATATGTGGATACTCTTG
CATTGTGCTTACAATCTCTTTATTTATTTGTAGATTGAAATCCAATACATACTATGGGAT
TGTTCCTATCATGCGATATCTTCCTATATCTTTCGAGTAAAACGGGTCACATGACACATC
CATGGAGACCAGAGAAAGCACATTCTGACACATCAATGGATTCAAAGACGAAGATTAAGT
TGACGATCTCTTGTGACCAAAACACACTTTAAAACATACGATATAAGCTCCTTTATGGGT
ATCAAACCCTATGGGATCCTCCCTATAATGAGTCCTATACCTTTACCTTGATTACGCCAT
TCCCAGATACCCATTTCATCTTCAGATTGGTCTGAGATTATGCGAAAATATACACTCATA
TACATAAATACTGACAGTTTGAGCTACCAATTCAGTGTAGCCCATTACCTTACATAATTC
ACTCAAATGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL766069 [GenBank]
Graphic View Graphic view of gene At5g60450
Predicted Position of Insertion Chr5:24308292 - go to primer design
BLAST e Value 9e-39
Hit Clone Code (BAC ID) MUF9
Hit Gene Code At5g60450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin response factor 4
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL766070 [GenBank] AL766069 [GenBank]


Last Updated on 31.08.2016 09:40