SimpleSearch - Line and FST details


Line specific information

 
Line ID 146F12
Vector Used pAC161
Line Availability only available from NASC (N413992)
Segregation Analysis 50:30:22
Confirmed for Hit MUF9
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g41762

 
Sequence (A. th genome BLAST matches underlined)
>94-K104557-0022-146-F12-8409
AGCCATTTACATTGAATATATCCTGCCCAGACTCCCTCAACACCCACCCCCATATATAGC
TTAATAGCCCTTTTCCCTCGTGGCACCAACAGACATTGAAATGTCTGAGGAGACACCGGT
GCCAAAAAAAAAGAAATACTTGGAATTTGAAAATTCTTTTTGGCATGCATCATAAGGATA
CTAAATCCTATTTTCGGGTAAATTTTCATAATTTTTTGACACCCCTATGGGATCCTCCCT
ATAGTGAGACGTGGGGCTCCGCGATTTGAACAGGCATGTAAGCACAAGGTGGAATAAACC
AAATAGAAGGAGAGAAGAATCCACCCCGAATAGAGGATACACGAAGTGCGGAGGTTGTGT
AAAGAAAAAAGGCGTGGGACGGAAGAAGTGTGACGGAAAGCTAAGGGAGCCATCAGTATA
AACACGCATAAAGTCCAGCGTCTTAAAATAATAACTATAGACGGAAAAACCGATGAGACA
GGCGAGGAGGATAGGCCACGAGAAGAATCTAATGAGATATGACGAGCGACAATAGAAATT
GAAAAAGATGAGAAGGCGAAAAAGGAGACGAGGAGCCGGATGGCAGGGCTCGAATAGGGA
GAACAGAACAGACAAACGAGCATTATGTCTTAGGAAAAGGTAAGTTGGTTTAGACACAAA
GGAAGAATACAGCTAGGAGAACCGGCGAGGCTAACACGACTAACATGAGAGAGAGAATTA
GCGATTAAGAGGCGCAGAAGGGACAAAGACAACGGAAAATGTGAAGTAGAACGGATAATA
TACGCCAATAGGGACGAAGCATGACGGCAACGAGGAGTGAGTAAAGAGTGCTAGAGGAGT
AAAAGAGTCGTGCAAGGGACAAAAAAAAGGAGTAAAACACGTAGAACGCTGAGGGCAAAG
AAAGAGAAAGGGACATTGGAATGTGATAATAAGAGCAGATAGAAACAATGCAGAGATATG
GCGAAGTCCACAAATAGCTTTTATAAAACAAGAACGAAGCAAGAAAAGAGGAATAGTGGT
ACGAAAAGAGAAATACTCAGAATACGCGTGAAAAACGTCATGTGAAAATGCGTCAGGAAA
TAGAAAGAACACAGGGGTATAAATAAAGAAG
GenBank Accession FR804393 [GenBank]
Graphic View Graphic view of gene At3g41762
Predicted Position of Insertion Chr3:14195868 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) F21A14
Hit Gene Code At3g41762 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit MUF9

 
Sequence (A. th genome BLAST matches underlined)
>82-K100823-0022-146-F12C-3144
TCCACTATCCTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACA
GGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGAGA
TACTCTTGTATTGATCATATGTGGATACTCTTGTATTGTTCTTACAATTTTTTTATTTAT
TTTTAGATTGATATCTAATACATACTAGATATTTGATGATGATTTAATCTTTTTTAAGGA
AAATAAATATTAGAGTATACTGCACGGATTAATTAAATAGAATGATGTGACATAGATTTA
GCCTTTTTTTCAACTAAAAGTTAACCTTAATTTTATTATATTTTCCTTAAATTTAACATT
AATTTTATTATATTTTCTATATTAGAATTAGATTTTTATCATTTTAGGAATATTTCACAA
TATCTGTATTTCATCATTATAAGGAATGAAATTAGAGGGAAAGCCA
GenBank Accession HG968778 [GenBank]
Graphic View Graphic view of sequence HG968778 of line 146F12
Predicted Position of Insertion Chr5:24308282 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MUF9
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23