SimpleSearch - Line and FST details


Line specific information

 
Line ID 147D08
Vector Used pAC161
Line Availability only available from NASC (N414060)
Segregation Analysis 100:96:92
Confirmed for Hit At5g41900
Parent of DUPLO pair none
Parent of pair(s) 3225, 3360

Gene hit At5g41900

 
Sequence (A. th genome BLAST matches underlined)
>60-K013070-022-147-D08-8409
NTGATCCATGTAGAATTTCCCGGACATGAAGCTCTTTACAATTGAATCTTAAAAGCTAGG
GAAGAGAGCCTCCGTCTAAAACGCGGATGACTGATGCCCACTCCTGTTAAACACAACGTC
GTACTATAGACCTTCTTGCTATGCTAACGTATTTGACATATATCTCATTTATTTTATATG
TTACCTTAATATATTACCTACAATAAGAAAACTGATGTGTATCCAATATCGGATATCGAC
AAGTAAAATATACGTAATGAGTATATTAAATTCTATGGGATCCTCCCTATAGGGAGAATA
TTTACCTCACCTCTGAATAATAGAAATGATAGGAAACTCGGGGGATCACTCCTATATCAG
GCAGTGGATTCCTAACTATAGAGAGACATATTGCTCAATGGAATCCGAGGAGGGTTCCGG
ATATAACCCTTTGCTGAAAAGTCTCAATCGCCCTCTGGGCTTCTGAGACTGCATCTTTGA
CATTTCCGGAGGAAACAAGCGTGTCGCGCCTCACCATGTAGACGAAGA
GenBank Accession BX511284 [GenBank]
Graphic View Graphic view of gene At5g41900
Predicted Position of Insertion Chr5:16770040 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) K16L22
Hit Gene Code At5g41900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934710 [GenBank]


Last Updated on 07.07.2016 14:03