SimpleSearch - Line and FST details


Line specific information

 
Line ID 148A10
Vector Used pAC161
Line Availability only available from NASC (N414122)
Segregation Analysis 50:9:9
Confirmed for Hit At5g18240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g18240

 
Sequence (A. th genome BLAST matches underlined)
>73-K013071-022-148-A10-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTACAT
GTAGATTTCCAGGACATGTAGAAGTCCTGGAAGATTGTCAATAGGAGTGGGATTACATGA
ACACAGAGGAAGGAGTAGCAACAACAGTGAGTATACAGAAGAAAGATTCAACGAGAATAA
TGAAGATTGCAAGCTTGAAACACACACAAGAACAGCTCTATGGGATCCTCCCTATAGTGA
GTCGTATTACTCAANNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNTNN
NNGNNTNNNNNNNNTNNNNATTNNTTCTNTTNNGNGNNTNNNNTTNNNTTTTNNTTTTTT
TTNNTTAATNNTTTTTTTTTAATAATTTNTTNNNTTTTNTTTTNTNTNTTNTTTTTNNTT
NTNNTNTTNTTTTNTTTTNTNTTTTNNTTNTTTTTTNTTTTTTNTNNTTTTTTTNTNTTT
NNNTTTTTTNTTNNNNTTTTNTTNNTTTTTNTTNNTTTTTTTTTTNNNNTTNTTTTAATN
NNNTTNNTTTTAATTTNTTATTATNNNNNAANNAAAAANNANTTNTTCTTTTTTTTTTAT
AAAAATATTAAATTTCCA
GenBank Accession AL757403 [GenBank]
Graphic View Graphic view of gene At5g18240
Predicted Position of Insertion Chr5:6028856 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) MRG7
Hit Gene Code At5g18240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb-related protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23