SimpleSearch - Line and FST details


Line specific information

 
Line ID 148C12
Vector Used pAC161
Line Availability only available from NASC (N414148)
Segregation Analysis 100:92:78
Confirmed for Hit At4g28490
Parent of DUPLO pair 2761
Parent of pair(s) 11872

Gene hit At4g32070

 
Sequence (A. th genome BLAST matches underlined)
>91-K013396-022-148-C12-35St
TTGACGAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGATTATTGGTAAAGAACCATTGTTCAAGCGAGAGTGCACTT
GAAGGTAATCAATTCTTGGCAAGAATACCAAACTCTGGACAAGTTACAACCCAATGGTTT
TCTGTTTATAACAATCTTAGAACAAACGCAGGTATGGGATTCAAGATTGATGAAATAGTG
CAGGCATGGAATGAGATGTATGATGCCAAGAGATGGCAGATGGGTGTCCCATCTTTCCGG
CTATAGGATCCTCCCTATAGAGAATCTATTTAACTTACATGATATCTTAGAGAATGTATT
TTCAGGGCCTGTTTGACGAAATATTCTTCTCATATACACAAAAAATATCAGCTGGCATCA
GATTTTGTGTATCACTATGGGATCCTCCCTATAGTGAGTCGTATTACT
GenBank Accession AL757428 [GenBank]
Graphic View Graphic view of gene At4g32070
Predicted Position of Insertion Chr4:15504951 - go to primer design
BLAST e Value 7e-120
Hit Clone Code (BAC ID) F10N7
Hit Gene Code At4g32070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Octicosapeptide/Phox/Bem1p (PB1) domain-containing protein / tetratricopeptide repeat (TPR)-containing protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g28490

 
Sequence (A. th genome BLAST matches underlined)
>91-K013071-022-148-C12-8409
NTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCATGTAGA
GTTGATTCTTACTGAGATCAAGCCTGCTCAATTGCTTCAATTTCACCAAGCTTTCAGGAA
TCTCACCGGAGAAATCATTCTCCGCTCCGGAAATCTCGATTATTCCGTTAAGCGATCCGA
TTTCGTTGGGGATTGAACCTGAAAATCGATTCTTTGAGATTCGTAGGTTCGATAGATTCT
TCGCGCCGATGATCGTCTTAGGAATACTTCCGGTGAACGAATTGTCAGAGAGTTCGAGAA
GTGACAAGCGAGGCAATCCCCAGAATCCATGTGGGATTTGACCCGAAAGCTTGTTGTTAC
TCAATCGGACCCGGGTCAAGCTCTTACACTTTCCGAGATTATTAGAGATTTCTCCTGAAA
ACGAATTGTCTATAAGAATTAGATACTCTATGGGATCCTCCCTATAGTGAGCGTTTTAC
GenBank Accession AL757427 [GenBank]
Graphic View Graphic view of gene At4g28490
Predicted Position of Insertion Chr4:14079427 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40