SimpleSearch - Line and FST details


Line specific information

 
Line ID 148G12
Vector Used pAC161
Line Availability only available from NASC (N414196)
Segregation Analysis 100:97:74
Confirmed for Hit At3g60130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g60130

 
Sequence (A. th genome BLAST matches underlined)
>95-K013396-022-148-G12-35St
CTGACGAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTAGAATTTGCTGCATCAAATTGGCTTCGATGCTTACCGATTTT
CGATCTCATGGTCACGGATTTTGCCTCGTAAGATATCGATATTATCGGATTAGATCTTTG
TAACTTGTAAGCGTTGTTATATATTCTTGATGTAACTCTTCTCAATTGTTTATTAGGTGG
GACTCTAAAGGGAGGAATCAACCAGGCTGGAATTGAATATTATAACAACTTGATTAATCA
ACTTATATCTAAAGGTAATGTTTCTCTGTTTCTCAGTCTATTTGATTTTAATGCACATAG
AGGAAATCTTGGTGATGTTTAGGATATTGCCAAAACCCTTGTAATTTTTTTT
GenBank Accession CR396306 [GenBank]
Graphic View Graphic view of gene At3g60130
Predicted Position of Insertion Chr3:22210996 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2O9
Hit Gene Code At3g60130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta glucosidase 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23