SimpleSearch - Line and FST details


Line specific information

 
Line ID 148H03
Vector Used pAC161
Line Availability only available from NASC (N414199)
Segregation Analysis 100:92:75
Confirmed for Hit At4g27830
Parent of DUPLO pair none
Parent of pair(s) 4815, 4840, 4922, 4935, 10149, 10924, 69861, 69864, 69868, 69871, 69880, 69881

Gene hit At4g27470

 
Sequence (A. th genome BLAST matches underlined)
>24-K013071-022-148-H03-8409
NTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATCCATCATAC
TCATTTGCCGATTAAAATTAGATTTCATTTTCCAAATGAGGATTACTACATTTATCTTAG
CCGATTAAAATTAGATTTCATTTTTCCAAACATGTGGCCTCAAAACCTCACCAATAAAAT
CTTCGTCCTTAGCTGAGAAAATAAGCTTGTTCATTCTAAAGTTTTTCATACCTTTCCATA
GCCCTAGGGGATGGGACCTATCGTGTGGCGGTTACTAAAAACTCAGAATATACGTCGACT
TTAAACATCTTCCAATCTCTGAAAGCCCCTCTCTTTTCTCCATTTCGTGCTTCATCATAT
TCGGCGTCGCTTCGGTAGGTTCTTCTTCATCTCTCTTCGATTGGATTGGATTGGATTCTA
TTTGAGTAAATTTGTTGTTGGCTCGCTGATCGCGTATGCCAACGGACTATTGAGGGCTCC
A
GenBank Accession AL757473 [GenBank]
Graphic View Graphic view of gene At4g27470
Predicted Position of Insertion Chr4:13734833 - go to primer design
BLAST e Value 8e-98
Hit Clone Code (BAC ID) F27G19
Hit Gene Code At4g27470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING membrane-anchor 3
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At4g27830

 
Sequence (A. th genome BLAST matches underlined)
>01-K118261-0022-148-H03C-8409
ATTTACATTGAATATATCCTGGAGACCATTTACAATTTACAACCCGGAGAATGTAGATTG
CCATTTACACATATTTGCATTCGGGTTATCTCCATATACAAACTCCAAGGATGATGAAAT
CGCAACTCAAAGAGCTAAAGCTTTCTTCTATGGCTGGTGAGCAAAAAGAAAGCTTTCTTT
CTCTGTGTTTCAATAACTTGCGGACAAAATCTGAAGACTAAAATGATAATTCAGGATGTT
GAAGCCTTTGGTATTTGGAGACTATCCGGATGAAATGAAGAGAACTGTTGGATCGAGATT
ACCGGTGTTTTCGGAGGAAGAGTCAGAGCAACTTAAAGGATCATCTGACTTTATAGGAAT
TATTCACTACACGACATTTTATGTCACAAACAAACCCTCACCTTCTATCTTTCCCAGCAT
GAATGAAGGCTTCTTTAAAGACATGGGAGTATATATGATTTGTAAGATTAGTTTTCTTTC
ATCATTAACCAATAGAAAAATGCTTCTGATCAATTCTTAAAACTAATAGTTCTTCTTCTT
TGGACAGCCGCTGCGAATTCTTCATTTCTTCTGGTAAGGTCCTGCAAATTTGCATAATAC
ATATATATTTTTTGCCAAAAGCTCTTCTTGAATCAATTGTTTTTCTTGAAGTGGGAGGCT
ACTCCATGGGGTCTTGAAGGTATTCTTGAGTATATAAAGCAGAGCTATAACAATCCTCCA
ATCTATATTCTTGAAAATGGTACAACACTTCATTCTCTTTTGTTTTCTTACTCTGTTGTG
TCTGCTTGAAAGCACACTTTTCTGTTCTTTAAGATTCTTCAACTTGCAATTTTTTAATAT
AAAA
GenBank Accession HG968781 [GenBank]
Graphic View Graphic view of gene At4g27830
Predicted Position of Insertion Chr4:13862985 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T27E11
Hit Gene Code At4g27830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta glucosidase 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649746 [GenBank]


Last Updated on 07.07.2016 14:03