SimpleSearch - Line and FST details


Line specific information

 
Line ID 149F01
Vector Used pAC161
Line Availability only available from NASC (N414269)
Segregation Analysis 100:65:58
Confirmed for Hit At5g19530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g19530

 
Sequence (A. th genome BLAST matches underlined)
>06-K013072-022-149-F01-8409
CGTGATCCATGTAGATTTCCCTNACCTGAANGCCTTTACAATTGAATATATCCACTGTAC
TATTTTTCGGTACCTGAAGCCCATATATATGTCCCTACAACCAACTATGACTGTGTGTTA
CTATCCAGCATGGCATTAACTATTAACACTAGATAAATAATACTCACACCTGTGCAAATT
TCCATTCGTACGAGTAAACACAAGACATCTAATCATAAATAGGAGAGAATAAATTGAGGA
TGAAGCATACCAATCAATGATTATTAGAACTTGATTGTCCTTGAAGCTAACTGCTGAATA
AAGACTCTTGAGTGCTACATCAAGAAAATGAAGAGAAGGCGGAATTTTACCATGATGACT
ATAAAACTGGATTATTACGAAACGAATAAACAGCGTACTTGACCTAGGGGATCCTCCCTA
TGTGAGCGTAAAACCTAATATACGTTCATGCATGATCTTAACAAATACATGTTGTTGCTT
TCTTCTTCTATGGGATCCTCCCTATAGTGAGTCGT
GenBank Accession AL757519 [GenBank]
Graphic View Graphic view of gene At5g19530
Predicted Position of Insertion Chr5:6590580 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) T20D1
Hit Gene Code At5g19530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T7D17

 
Sequence (A. th genome BLAST matches underlined)
>06-K013072-022-149-F01-8409
CGTGATCCATGTAGATTTCCCTNACCTGAANGCCTTTACAATTGAATATATCCACTGTAC
TATTTTTCGGTACCTGAAGCCCATATATATGTCCCTACAACCAACTATGACTGTGTGTTA
CTATCCAGCATGGCATTAACTATTAACACTAGATAAATAATACTCACACCTGTGCAAATT
TCCATTCGTACGAGTAAACACAAGACATCTAATCATAAATAGGAGAGAATAAATTGAGGA
TGAAGCATACCAATCAATGATTATTAGAACTTGATTGTCCTTGAAGCTAACTGCTGAATA
AAGACTCTTGAGTGCTACATCAAGAAAATGAAGAGAAGGCGGAATTTTACCATGATGACT
ATAAAACTGGATTATTACGAAACGAATAAACAGCGTACTTGACCTAGGGGATCCTCCCTA
TGTGAGCGTAAAACCTAATATACGTTCATGCATGATCTTAACAAATACATGTTGTTGCTT
TCTTCTTCTATGGGATCCTCCCTATAGTGAGTCGT
GenBank Accession AL757519 [GenBank]
Graphic View Graphic view of sequence AL757519 of line 149F01
Predicted Position of Insertion Chr2:17007419 - go to primer design
BLAST e Value 5e-65
Hit Clone Code (BAC ID) T7D17
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40