SimpleSearch - Line and FST details


Line specific information

 
Line ID 149H10
Vector Used pAC161
Line Availability only available from NASC (N414302)
Segregation Analysis 100:93:90
Confirmed for Hit At2g05710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53830

 
Sequence (A. th genome BLAST matches underlined)
>80-K013397-022-149-H10-35St
TTGCGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCGGTGATAGTTCTTGAGTTTCATTGGACTCAGAGAGAGAGAATCGATTA
CGGGGATTTACGTTGTGCCACCTAGGATACCACGTCATCTTAGTGACACGTGGCGTGATC
TATGGGATCCTGCCTATAGCTGAGTCCATTTACTCATAATTCGGAAGTCTTTGTTCGGAC
GGGTCTACTTTCACGTCCGACTGGGGGCTTAGATGACAAACTACAAGACCGATGCCTTGA
ATGCGACATTCCTAAACACACATTTCATCTTCAGATAGGTCTGAGATTATGCGAATACAT
TCACTCATATACGTGGGTCCTGACAGTATGATCTACCAATCCAGCGTATGCCATTACCTT
ACCTAATTCACTCTTCTGCTATGGGATGCTCCCTATAGTGAGTAATTTTACCTCTCCTTT
TCATAAATGCCTGGCCGGTTGGACCTACCAATTCAGGGTAGCCCCTTTACGTAACATAAT
TCACTCCAACGCTA
GenBank Accession AL757544 [GenBank]
Graphic View Graphic view of gene At3g53830
Predicted Position of Insertion Chr3:19940667 - go to primer design
BLAST e Value 6e-34
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Regulator of chromosome condensation (RCC1) family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g05710

 
Sequence (A. th genome BLAST matches underlined)
>80-K013072-022-149-H10-8409
TTGATCCATGTAGATTNTCCCGTACNTGAANGCCTTTACCAATTGAATATTGGGGAGCCT
AAGCGTGTAAGAATAACCCACTGAAACTCATATATTGCATGAGATCACTCACCTTTTAAC
CTAATCCTATGGGATCCTCCCTATAGTGAGTCTATTTACTCACTCAGATCATGTTCAAGA
ACACCTGCTCTATTCAAATCTACTTGCACCATTAGAGTAACCAACTAATACATAAGAAAC
ACAAACATCTTGCAGCTGAAGCCTAAAACCAATACAAGAATCTGATAAAACCAAACTGAA
ACTTGTCATAAATTCCATATGAACCTGAGAGTAATCTCCTGTGTCTGAATGAAGTAACTT
GCCAGCATCTTCTTCCATATGAACCCTATGGGATCCTCCCTATAGTGAGTCTTTTTACT
GenBank Accession AL757543 [GenBank]
Graphic View Graphic view of gene At2g05710
Predicted Position of Insertion Chr2:2146558 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) T3P4
Hit Gene Code At2g05710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03