SimpleSearch - Line and FST details


Line specific information

 
Line ID 150H03
Vector Used pAC161
Line Availability only available from NASC (N414391)
Segregation Analysis 100:73:53
Confirmed for Hit At4g40020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g37475

 
Sequence (A. th genome BLAST matches underlined)
>24-K028794-022-150-H03-8409
TTTACACTTTTGAAGATTGCATTTTACCTCCTATAGGATTGTACCTGAGAAGAGGTTTAN
NTCGTCGGCNGGNTTTTTGTTTTCTATAAAGAATTGCANNAGTGTTTTTCTTCTGTTTTC
TTTGCTCGGNTTGATTTATCAGTTTGTGTAGTAAAATTTGTTGTGGGCGCTTTATTTAAT
AAAATATGATTTGAACGACTAAGGGGATCGGGGCAATAGAGAGAAATTATAATACAGATC
TGTCGCGAAAGGGTCTCACTATAGGGAGGATCCAATTCGGGTAGGAGAAAAGGAAATTAT
TAAAGGAAAAAGAATTTAGAATAGAGGTTGACAAAAGAATAAAAAGATAAAGAATTAAGA
GGAAGGAGGAGAAATGACAGAGGCGATTTATTGTGAGAAAATGCAGTCAGCGAGAGTGGA
AGATACAGAGAAGAGGAGGAGAGGGGAATA
GenBank Accession CR934819 [GenBank]
Graphic View Graphic view of gene At5g37475
Predicted Position of Insertion Chr5:14866316 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) T25O11
Hit Gene Code At5g37475 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Translation initiation factor eIF3 subunit
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit CR770256 [GenBank]

Gene hit At4g40030

 
Sequence (A. th genome BLAST matches underlined)
>24-K013398-022-150-H03-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTAAAAGAATCAGATTTTGGTCAATATGGACAATCAGATTTGA
CCAAAGAAAATAATAATATCAGACGATAAAATAGACGGCTCTCGATAAAACTAACCCTAA
AAATAAGGAAATAAGTTCCTCTTTGAACCAAATTTTCTTTCTTTGACCAATAGATCTTTT
TGTCAACCTCTTAAATATATTCTTAGTCAATCTTCTAATAAACCCATTGGCCATTACCAA
AAATTCCTCGGAAACGCTGAATAAAAAACATTCTATCATCTATGGGAGAAGTCGATGAGA
AACCGTCCATTGATGTAGCTTCTCCAAGGTATTCATCGAACAAAGTTGCGGATATTGGTA
CAGAGCTTTACAAAATGAAAGCTTCCCTTGAGAACAGAGAACACGAAGTCGTTTCTTTAA
AACAAGAGTTATTGAAGAAAGACATCTTCATCAAGAATCTTGAAGCTGCAAAGAAGAAAC
TGCTTGATTCGCTTAAGGATCAATCGCGAGAGTTAGAGGAAACCAAACGCTTGGTAGAAG
ACGCCAAGGTACAGATTGGTTTATTAAAACAAAGAAAAGAACTTTTTACA
GenBank Accession AL757598 [GenBank]
Graphic View Graphic view of gene At4g40030
Predicted Position of Insertion Chr4:18555546 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5J17
Hit Gene Code At4g40030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Histone superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL757598 [GenBank]


Last Updated on 31.08.2016 09:40