SimpleSearch - Line and FST details


Line specific information

 
Line ID 151C10
Vector Used pAC161
Line Availability only available from NASC (N414434)
Segregation Analysis 50:50:38
Confirmed for Hit At5g43170
Parent of DUPLO pair none
Parent of pair(s) 3190

Gene hit At5g43170

 
Sequence (A. th genome BLAST matches underlined)
>75-K013133-022-151-C10-8409
NTTGATCCATGTAGATTTCCCGGACATGAAGCCTTTACATTGTGAAATACATGGCTGGCG
GCCGCCGACAGCTTGACCGGTGGCGAAAGATCTGCCGCAACACTCGAAGACACGTGAGAT
TTCACGGAGGTGGATGGTGACCACTTTACTCATTCTCTCCACCACCGTATAATCTCCGGT
GGCTGGCTTTATGACCGCCGAGAGCTTGGTAAGACGAAGACGTCGTTGAACATACGCCAC
ACTGATAACTGGGCTTCTCCGCAACCGACACAGAGTCAAGATCGCCGCCATCCCGAGCAA
GAAGCATGAGACAGAAAGCTATGGGATCCT
GenBank Accession AL757650 [GenBank]
Graphic View Graphic view of gene At5g43170
Predicted Position of Insertion Chr5:17331225 - go to primer design
BLAST e Value 4e-84
Hit Clone Code (BAC ID) MMG4
Hit Gene Code At5g43170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc-finger protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR804548 [GenBank]


Last Updated on 31.08.2016 09:40