SimpleSearch - Line and FST details


Line specific information

 
Line ID 151F10
Vector Used pAC161
Line Availability only available from NASC (N414470)
Segregation Analysis 50:49:39
Confirmed for Hit At2g29990
Parent of DUPLO pair 2806
Parent of pair(s) none

Gene hit At2g29990

 
Sequence (A. th genome BLAST matches underlined)
>78-K013133-022-151-F10-8409
TTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGATAT
TCTTTCATCCTTCGATGATCGTCTCAAACGTTATGCTATCAAGCAGTTAAACAAAGTGAA
CTCATTTTGAAGTTATAACATGTCAAGGTTTTGAGCCTACTTTTATGGAGCGTTTCTTCT
TAAGAACTCCTGGTTTTGATTTACATTACTCTGGAGTACGGTTTGTGCGAGGGATTGTGA
AAGATGTGCAGACTCACAAGTTAATACTTGTCGATGGCACAGAGGTTCCCTACTGACTCT
TAGTGTGGTCCACTGGTGTTGGACCTTCTCCTTTCGTTACGTGTCTTGGTCTTACACAAG
ATACTACTGAAAGGTTAGTTAGACCACTCCATTACACTCTTTATAATTAGAAAGAATATC
GCCTTCACCTTAACTTCTTGGATGTCTATCTCTATAGGATCTGCACTAGTCGACTATATC
CGCGTACCTTAAGCACACAACGACTTCCATGTCGGTGATGTGACCAATTCATCAGGGCAC
CTCCTGACAAGAAACCTATTACTGATCTACTGGATTCTCCTGAGAGCCCACAGAAACAAA
AACTAACTCTACATTTTCCTTTGAAACTCCATTGCTTTTCTTCCTCGATTTCGTTTACCA
AGAAGAACCTTTAAAAATAGGCTAATTTCTCTAGAACCAAGAGAATCCTGACCTTCTACC
TAAAGCCCAAGAATTGGCTTCTAAGCCTAAACCGGGGGGCTGCGCTGTGACTTGCCCGAA
TGGGCGCGGAAACGTTGCCCGAATTAGAAACTTTTTCTGA
GenBank Accession AL757697 [GenBank]
Graphic View Graphic view of gene At2g29990
Predicted Position of Insertion Chr2:12794598 - go to primer design
BLAST e Value 4e-155
Hit Clone Code (BAC ID) F23F1
Hit Gene Code At2g29990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alternative NAD(P)H dehydrogenase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03