SimpleSearch - Line and FST details


Line specific information

 
Line ID 152F02
Vector Used pAC161
Line Availability only available from NASC (N414558)
Segregation Analysis 50:47:35
Confirmed for Hit At3g05160
Parent of DUPLO pair none
Parent of pair(s) 96391, 96404, 96415, 96436, 96448, 96459, 96469, 96475, 96477, 96478, 96479, 96480, 96482, 96483

Gene hit At3g52050

 
Sequence (A. th genome BLAST matches underlined)
>14-K013134-022-152-F02-8409
TTGATCCATGTAGATTCCCCGGCACATGAAGCGCTTGGATGACGAGTCTCTCACGCCGAG
AGAATACTAGCGAGGATGAGGATATTGGACTGTGAATCAGATACTTACGCCGCAGATCGG
GCGCACTGAATTTGAATCTTCTCACTTGAACAAACCACTGGCCTCATGAAAGAACCGAAC
CTCCGATATTCATTAATCTTATGTATGGGAATCCTCCTAAAGATTGATTCGATAACTGGT
TATGATTCATGGCGACTGTGTTTGCTACGCTAAGGTTAAACGCTCTTCTTCTTCATGACA
ATACTTTCAGCGACGTGGATGACGCTGCTCCTGTGATATCACTCCCGTTTTCTATGGAGG
AATCTCTGTCTTCCTCGGAGTGTTGGAAACTGGAGTAAACGGAACTGTGCTCTCATCTCT
CCTTCCCTTGCTCGCTCTGAGAAGGTGATACTTGTACTCGTATCGACCAATTCTGAGCTA
TTTAGATGTGCGCTATGACTCTTGCTATGAAGACACATGGCGATTATGGCATTGACAATT
TGGAAATACCAGATTTTCTGAATCAAGGGAATGTTTCTTTCGCGACATTTCTTGTTACTA
TAAACTCAGAATGGATCTTGGAGGATACTT
GenBank Accession AL757800 [GenBank]
Graphic View Graphic view of gene At3g52050
Predicted Position of Insertion Chr3:19304969 - go to primer design
BLAST e Value 1e-87
Hit Clone Code (BAC ID) F4F15
Hit Gene Code At3g52050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'-3' exonuclease family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At3g05160

 
Sequence (A. th genome BLAST matches underlined)
>14-K013139-022-152-F02-8409
TTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGTAATATTATAAGTGCTA
ATAGTTATCTTATATTAGTCCATATTAGGAAACAAGAGTAACCTGTAACGTGAAGCTAAC
CCCAATAAGCAAGGATCCGATAGACATTCCAACAGCAGAAGCCTATGGGATCCTCCTAAT
AGTGAANNNNCNCTATCANATTGGCTTANATGATACTTGTATTGAGGATATAACTCTTAT
CTACAATGGTCCCCTGCTTTGTTCTATATTGGCACATATAGTTCTTTAGCTATCTGAGAT
ACTTGATGGCCATGAGACTAATTAGCAGCATGATCTGATGTTCCCTGCACAAACATTCGA
TATCCTCGGATCAATAACTAAACGACATTACCAACCCGAATATACGCGAGATCATACTCA
CGTGTATTACTCAAACCGGACATTTGACAAACGACATCTTCTCGACATTCTGCACTCACG
ACAATTAAACTTCAGNTCATAATCTCTGCAGGGACTGGGGAAAACACGAAAGCGTGTCCA
CGAACCTTGGAAATGTCGTACCGGTCCCTCCGCGTACAGGGGATATGACTCTATAACCGG
AGCCCTCTCGCTTTGTAGACCCCCGGCTCGCAAGTCGGGGAACCCAGAACACACTGCTAA
GCGGGGGTAACTACCTCCAGGATGCACTACTATAAACCGCGTGGCAGCTCGCCGGCCGCC
TTTTGTACTTGCGTTTTTTCGTGGGCAGCAACCCGTTTTCCCCCACGGCCTTTGT
GenBank Accession AL757801 [GenBank]
Graphic View Graphic view of gene At3g05160
Predicted Position of Insertion Chr3:1453970 - go to primer design
BLAST e Value 2e-61
Hit Clone Code (BAC ID) T12H1
Hit Gene Code At3g05160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40