SimpleSearch - Line and FST details


Line specific information

 
Line ID 153A10
Vector Used pAC161
Line Availability only available from NASC (N414602)
Segregation Analysis 50:27:19
Confirmed for Hit At3g60800
Parent of DUPLO pair none
Parent of pair(s) 1451, 2396

Gene hit At3g60800

Sequence (A. th genome BLAST matches underlined)
>73-K012818-022-153-A10-35St
CCTGGACGTAAGGGGGGACGCTCACTTCTACTGATGCCTTCGCAGACCCTTCCTCTATAT
AAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCG
CCTTCGGTTTAAACTATCAGTGTATAAACCTAACAGAACTTGAATACGTTCCACGCCATT
GTTGTACCAGATCTATGCATAGTCAAAAGCAACGATCGAAAGAAAACCTTTCTGGATCTT
CCTTCCGGAGTAAAAGGAAAGACGCGTAGTCAAGGCCAAGGAAGAAATGAAATAAGTGTT
TCTGGGGAGATTTCGAAGAGGTCTTAGGGTTTCTTTAAATCTGGAAACAAAATCAAAACA
AGGGGTTTAAGGAATAATAATATGAGAGTGCTAAATTGTAAGATGCAGAGACCCCATGAA
GGAGGAATGATGCGGAGCTTGAGGAATGAGACTTTTTCTCCTTCTTGGATTCGTTTTCCT
CTTTTGGAGCTAACAAGAAATTTCAGACGAAACACTTTTAACTTTAGATTTGTAATTTAA
TGACTTTTAGTCAATCAATCTTTCAGAAGCCCAAACTCAAACTGTGTAAATAATATGTAT
TTTTTACTACTATGGGATCCTCCCTATAGTGAGTCG
GenBank Accession AL757848 [GenBank]
Graphic View Graphic view of gene At3g60800
Predicted Position of Insertion Chr3:22469226 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T4C21
Hit Gene Code At3g60800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DHHC-type zinc finger family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Li et al. 2016, atpat14-2]
Other FSTs Supporting this Hit AL757848 [GenBank]


Last Updated on 31.08.2016 09:40