SimpleSearch - Line and FST details


Line specific information

 
Line ID 155A07
Vector Used pAC161
Line Availability only available from NASC (N414791)
Segregation Analysis 100:95:71
Confirmed for Hit At5g01490
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g61430 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in MGH6 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g61430

 
Sequence (A. th genome BLAST matches underlined)
>49-K013136-022-155-A07-8409
NTGATCCATGTAGATTNTCCCGGGACATGAAGCCTTTACAATTGAAATGAGTGAACTTGA
AGCTGCCATTAGTGTGCACTAAAGACTGATTCTAATATTGGATTTGTTGCTTACCGGCTT
GAGTTTTGTAATAATTGTGCAGATTCTTGCACCACTCCCAATCGGGTTTGCGGTTTTCTT
GGTTCACTTGGCAACCATCCCAATCACTGGCACAGGCATCAACCCAGCTATGGGATCCTC
TAATTAGTGAANNAAANNANATCAACGCATTATTTTTGTGGTTTAATCTATGGGATCCTC
CCTATAGTGAGNN
GenBank Accession AL758005 [GenBank]
Graphic View Graphic view of gene At3g61430
Predicted Position of Insertion Chr3:22734677 - go to primer design
BLAST e Value 8e-101
Hit Clone Code (BAC ID) F2A19
Hit Gene Code At3g61430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation plasma membrane intrinsic protein 1A
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g01490

 
Sequence (A. th genome BLAST matches underlined)
>20-K032733-022-155-A07C-3144
CCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACC
CGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACATATAATGATAGAAAGCAAATA
AATGGTAAAAGAAGAAAACAAAGAAGAATAAATTACTCGGTGAGAAAACTGATACGTTCG
GCCAAAGGTGTCAATCCCAGCAAGCTCAACGCAAAGACCCACGCCTGTTTTTTTGTTACA
CCACGCAATAACAATTAACATAACATATGGTTTAAGACGAATGTTTGGTTTATTATTCCG
ATAAAATAAAGATATATTTGTTGGAACTTACACGTGGACAGTCATAGCGGTGAGCGACGA
CGGCGAGAGGAACGGCCGGGAAGAGGATGAACAATTTGGTGCCGAGAAGAACTTCTTGAA
GATTCGTCAAGATTCGTCTCATAAACTCCCANCCGAACT
GenBank Accession HG968786 [GenBank]
Graphic View Graphic view of gene At5g01490
Predicted Position of Insertion Chr5:196102 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7A7
Hit Gene Code At5g01490 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cation exchanger 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285236 [GenBank]

Gene hit MGH6

 
Sequence (A. th genome BLAST matches underlined)
>49-K013141-022-155-A07-8409
NTGATCCATGTAGATTGTCCCGGACATGAAGACCTTTACAATTGAATATATTCTACATTG
AAGCTGCCATTTGTGTGCACTACAAGACATGTTGTACTATTGGATAAGTTGCATACCGGT
TTGTGATTGGCAATACTTGAGAGAATACTTGCACCACTCCCACATGCGTGATGGCGGATC
TTTTGGTATCACTTGGACACCATCCCAATCAGAGGCGCAGGCATCAACCCGATTTAATGC
ATGCCATGGAATTATTACTATCTTTCTGCATTATATATTACATAGCATCCTATGGGATCC
TCCC
GenBank Accession AL758006 [GenBank]
Graphic View Graphic view of sequence AL758006 of line 155A07
Predicted Position of Insertion Chr3:4138141 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) MGH6
Insertion Classification Genome Hit
Confirmation Status failed


Last Updated on 14.10.2014 10:23