SimpleSearch - Line and FST details


Line specific information

 
Line ID 156G02
Vector Used pAC161
Line Availability available as T3 set from NASC (N414954)
Segregation Analysis 50:48:34
Confirmed for Hit At5g58430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g58430

 
Sequence (A. th genome BLAST matches underlined) 
>15-K013211-022-156-G02-8409
TTTGATCCTGTAGATTTCCCGGACTGAAGCACTTACATTGAAATATCCTGATGAATAATG
GGAGATACATTGTTAGAAAGTAAAGATGGAGACCTAGCCTGCTTCTTGATGTATACACTA
CCC
GenBank Accession AL758221 [GenBank]
Graphic View Graphic view of gene At5g58430
Predicted Position of Insertion Chr5:23621930 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein B1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37