SimpleSearch - Line and FST details


Line specific information

 
Line ID 157B01
Vector Used pAC161
Line Availability only available from NASC (N414989)
Segregation Analysis 50:46:37
Confirmed for Hit At5g59845
Parent of DUPLO pair none
Parent of pair(s) 6856, 68595

Gene hit At5g59845

 
Sequence (A. th genome BLAST matches underlined)
>02-K013241-022-157-B01-8409
TTTGATCCATGTAGAATTTCCCGGACATGAAAGCATTTACACTTTATTGTTGCTGATCAT
TGGGGTAACAAGGGCATTCATCTTTGTTTCCATAAGTGCCTGAAGGAACACAATAGTTAC
ACTTATCGCAACATATATTACAAGATCTTGAGACACCTATCTTGTCTTCCTGCCTTTGAA
CATCTCACGTTGCATTATCCTCCGCATGGAGCTAATTAATCCATCATCACAATACAATTT
TATTAAGAAAGCTAAATTTCTAATGAGAAAAGTCTCTAAAATAAGAAAATGCATTGTGTA
TACTTACACGAATCCGCGGTTGAGAGTATGAACAAAGAACATGTGATGAGAACAGAGATA
ATAAGAACTTTTACAGCCGGGAATTTCATCGTAGTTCTTGATGAGATTGTTTTAATAATA
ATCTGTGAGGAGAAAGTTTGTTACTTTGAGAAGATGAAAAGAAAACTCGAAGGTTTCACA
CAATGCAAAAGGAGTGATGGTTCGGGAAGAAAACGAGGTTACAAAAAGAGTTACTTATAG
GGAAATATTGGAGTAGGAGAAACGCTTGCTACCTATGGGATCCTCCTTTTTAGGGACCTT
ATTTNCAAAACTTTGACTCCATGGTGAATGGGGGACCCCCCAGGGAGGGCCTCCTTACAC
CAGAAAACCAACGTCAGAAGCACCAACTCAATCAATACGAACCCCAAATAAAAACGTCCG
CCGGATGTTCCCACACTTGTAGTGATCATTAGTCACTTTTATGTCACGCGTATGTAAATA
TAGTATATGTTTCCCACAATCTTACCTCTTTTAATAAA
GenBank Accession AL758270 [GenBank]
Graphic View Graphic view of gene At5g59845
Predicted Position of Insertion Chr5:24111772 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MMN10
Hit Gene Code At5g59845 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Gibberellin-regulated family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23