SimpleSearch - Line and FST details


Line specific information

 
Line ID 157C08
Vector Used pAC161
Line Availability only available from NASC (N415008)
Segregation Analysis 100:93:80
Confirmed for Hit At4g37940
Parent of DUPLO pair none
Parent of pair(s) 3614, 3615, 3690, 78957

Gene hit At4g37940

 
Sequence (A. th genome BLAST matches underlined)
>59-K013241-022-157-C08-8409
TGATCCATGTAGATTTCCCGGACATGAANGCATTTACAATTGAAGAATACCGATGATTTT
GATGAAAGCATGACAGCTATTGCCTGAGAACAGGGCCTCACTCTCTGCCAAACTGTAACA
CAGCACACAACTAAACTCTACAGACTTTGAACATATCAGGAAACCAAAATCTCATTTCAA
AAATCAAACATCATGCTAAAGCATCAATCAATATATAATCACATATCTTTAGAGTTGTCG
CTATATCTATATGTATACCTTGACTTCTGATGCGGGGTTCAATAGTTGTTGTTGCTCGAT
CTTGCTCTTGTTGTATCTATCAATAACCGACTTCATGCTATTCAAAATATTTAATATTAG
TATACCTTGTTCATGGTATATAATTCACTCATATCATATCATCTCTTAGAGTAAATTACG
TAAAAGATATTAATTTTCGATCGTGAAGTTTTTCCAAGTACTCCATTAAAAAGCTTTCAT
ACGTAAAGAAAAAACTCATAGCCTATGGGATCCTC
GenBank Accession BX546554 [GenBank]
Graphic View Graphic view of gene At4g37940
Predicted Position of Insertion Chr4:17836483 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g37940 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 21
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23