SimpleSearch - Line and FST details


Line specific information

 
Line ID 157D10
Vector Used pAC161
Line Availability only available from NASC (N415022)
Segregation Analysis 100:89:85
Confirmed for Hit At3g22200
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit K18L3

 
Sequence (A. th genome BLAST matches underlined)
>76-K013241-022-157-D10-8409
NTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGAAAT
ACACATTTCCGTCATACTCTTCTATCATACCTTTAGGATTAATGAGAAAAACACTTCAAA
TTAAAGGTGTTATATGATCTCTAAGTCATATGGGGGTTATCAATTTTATGTTGTATACAC
TTATTATGCAAGACTGTATACCATTGTTAGACGATAATATCTTCTGGTGACTCTCTCTCT
CAAATGAAACGAGTATAACGACCTGTCGCCCCCCTAGGGAACTCCTACCTATTACTGACG
AAAACTCTTGGCCTTATGCCACTATGGGACCCTCCCTATAGTGAAAAGATTAGGTTATTT
ACAAGGTGTGTGGTTAATATTTTGTCACAAAAGAGTTAGGCTGAAGTATTAGTCTTGATA
TGAAGATTTCTTAACATCTAAATAAGCCAAAGGAGTTTTTTTTTAGTCATAGCCATACTC
CTGTATTTTGCCTCATTATTACTGTTACTTACAATGTCTTGTGACTTCTATGTGATTAAT
GGAATTCCAAGAAAAACACATATTCCCGAAGTACATCTTCTTGAGTCAATGCAAGTGCCC
CAATCTGCACCAGTAAAANCATTCAAGCAAAAATCTTGTGAAGCAGAATATAAAAAACCT
TGGCCCTGGATTGTTCTTGAGGTACTTCAAGATTTAATGAGCAGCTTGGAGGTGTCCGTC
CATCACATGGGGAAAAATAAAAATGGACTTAAGCGATTGACTACCAAAGTT
GenBank Accession AL758306 [GenBank]
Graphic View Graphic view of sequence AL758306 of line 157D10
Predicted Position of Insertion Chr5:15081187 - go to primer design
BLAST e Value 6e-179
Hit Clone Code (BAC ID) K18L3
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g22200

Sequence (A. th genome BLAST matches underlined)
>76-K013213-022-157-D10-8409
TTGATCCATGTAGATTNTCCCGGNACATGAAGCCTTTACAATTGAATATATCCATTTACA
TGGGGAAGGCTGGAACAACAAACTAACTTTGTTAGGGAAAAGAAGGAATCTTTAGCACTT
CTATGGGATCCTCCTNATAGTGAGCCATTTCACACAGTATCAGTATCTGGTATTATACCC
TTTGAATGGCTCGCTCACGCGATACGGAAGACGACTTCTCAACCTGATTAGCCTAGAATT
AAGAGGATCTAATGATCAAAGAATGACCAGAACCTGTAAACTTCTATAGTGACTTACGAA
AATTCTTGTCTTTATGCT
GenBank Accession AL758305 [GenBank]
Graphic View Graphic view of gene At3g22200
Predicted Position of Insertion Chr3:7837017 - go to primer design
BLAST e Value 7e-49
Hit Clone Code (BAC ID) MKA23
Hit Gene Code At3g22200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pyridoxal phosphate (PLP)-dependent transferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Scholz et al. 2015, pop2-5]


Last Updated on 31.08.2016 09:40