SimpleSearch - Line and FST details


Line specific information

 
Line ID 157F08
Vector Used pAC161
Line Availability only available from NASC (N415044)
Segregation Analysis 100:91:87
Confirmed for Hit At4g15740 At4g02050
Parent of DUPLO pair none
Parent of pair(s) 6095, 6104, 6157, 6159, 6165, 6176, 7738, 8818, 77112, 77136, 77137, 77138, 77139

Gene hit At4g15740

 
Sequence (A. th genome BLAST matches underlined)
>62-K013241-022-157-F08-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCTAAT
ACTAACGGACCCATCTTTTGCTATTATACCCATCTATGGGAGCGTATCTATCTTCATACC
GTTGGCATCGCTTTTGTATGTCTACGGTAAAGGCGGATTAGAGACCGTTATACTGTTGCA
TGGGAAGTCTAACATATCCAATCTTCTTTTTACCTAGGAAAGGCCGGTGGCTCATCAACT
CCACAAGGAGCATCAACCGCCCTTCTTGAGCTGACTTCTTATCAATAGAAAATTTCATCA
TTTGATTCCACTTTGGATTTGAATAAACGGCAAAAACCACCGGTGTGCTGATCCTATTCT
TAACTTTTCTGTCCTTAAGAATCGCAACCGAAGCGTATACGTCCATGGACGAGAAGGCGT
TGACATCTTCGATGTTCTTGGCGAATTTGATCACGAGCCCTATGGGATCCTCCC
GenBank Accession AL758333 [GenBank]
Graphic View Graphic view of gene At4g15740
Predicted Position of Insertion Chr4:8965222 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-dependent lipid-binding (CaLB domain) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g02050

 
Sequence (A. th genome BLAST matches underlined)
>62-K013213-022-157-F08-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAACTGTCGGTATCTTTACAGC
GAACATGGTCTCATTCCGGTACTCAACAGCCTTATGCCTTGGAGGACTGGCGTACTCTCT
CTTGGTTTAGCTGCTTTTCCAGCTCTGCTTATGACGCTTGGCGGGTATTTCTTACCCGAG
ACACCAAACAGTTTGGTCGAAAGAGGATTAACAGAGAGAGGTCGACGAGTCTTAGTGAAG
CTAACAGGAACAGAATACGTCAACGCCGAGCTTCAAGACATGGTATATGCGAGTGAGCTT
GCGAATTCCATCAAACATGCATTCAGAAACATCTTGCAAAAACGACACAGGCCTCAGCTA
TGGGATCCTCCCTTNAGTGANNNAANCNCNNCCGAAGCGTTTCCGTCCATGGACGAAANG
GCGTTGACATCTTCGATGTTCTTGGNGAATNTGATCNCGAGC
GenBank Accession BX572197 [GenBank]
Graphic View Graphic view of gene At4g02050
Predicted Position of Insertion Chr4:899389 - go to primer design
BLAST e Value 5e-133
Hit Clone Code (BAC ID) T10M13
Hit Gene Code At4g02050 [TAIR] [MIPS] [SIGnAL]
Gene Annotation sugar transporter protein 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23